ID: 1114723862

View in Genome Browser
Species Human (GRCh38)
Location 14:24912706-24912728
Sequence CAGAACAGCACCAGATAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114723862_1114723864 27 Left 1114723862 14:24912706-24912728 CCATGCTATCTGGTGCTGTTCTG 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1114723864 14:24912756-24912778 CTTAGAAGCTTTATAGAACATGG 0: 1
1: 0
2: 1
3: 21
4: 230
1114723862_1114723863 2 Left 1114723862 14:24912706-24912728 CCATGCTATCTGGTGCTGTTCTG 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1114723863 14:24912731-24912753 ATAAGAAAAAAATTGCTATAAGG 0: 1
1: 0
2: 4
3: 84
4: 1005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114723862 Original CRISPR CAGAACAGCACCAGATAGCA TGG (reversed) Intronic
901672089 1:10861957-10861979 CAGGACCGCACCAGATCCCAGGG - Intergenic
902186484 1:14729269-14729291 AGGAACACAACCAGATAGCAAGG - Intronic
902839262 1:19065079-19065101 CAGAGCAGCACGACATGGCAGGG + Intergenic
904659742 1:32075493-32075515 CAGAAAAGCAGCTCATAGCAAGG - Intronic
907675647 1:56515548-56515570 CAGAATAGCTCCAGAAAGGAAGG + Intronic
908677972 1:66627441-66627463 GAGACCAGGACCAGATAGGAAGG + Intronic
909361315 1:74762116-74762138 AAGCACAGCACTAGATATCAAGG + Intronic
911843515 1:102717001-102717023 CAGAACAGGACCAAGTAACAAGG - Intergenic
912458991 1:109818786-109818808 CAGAACAGAGCCAGGAAGCAGGG - Intergenic
915996794 1:160571880-160571902 CAGAACAGCACAAGATACACAGG + Intronic
918092866 1:181312606-181312628 GAGAACAGAACCGGAAAGCATGG - Intergenic
918128819 1:181607268-181607290 CAGAACAGGACTAGGTAGGAGGG - Intronic
920263045 1:204702837-204702859 CAGATCAGCACTTGATGGCACGG - Intergenic
920853380 1:209644620-209644642 CAGAACAGCACCAGTATGCTGGG - Intronic
923183443 1:231546787-231546809 CAGCAGAGCCCCAGAGAGCATGG - Intronic
923887290 1:238173172-238173194 GAGAACAGCACCAAACAGGATGG - Intergenic
924695446 1:246395223-246395245 CAAACCAGAACCAAATAGCATGG + Intronic
1062984949 10:1759976-1759998 CAAAACAGCAGGAGATAGCAGGG + Intergenic
1063283720 10:4660596-4660618 GAGAAGAGCAAGAGATAGCATGG - Intergenic
1063488564 10:6442564-6442586 CTGAACAGCCATAGATAGCAAGG - Intronic
1063796407 10:9517968-9517990 CAGCTCAGCACCACAGAGCAAGG + Intergenic
1064628520 10:17285717-17285739 CAGAGCAGGACCAGAGAGAAGGG + Intergenic
1064776836 10:18788064-18788086 CAAGACAGCAGAAGATAGCAAGG - Intergenic
1069234966 10:66059616-66059638 CAGAGCAACATAAGATAGCATGG - Intronic
1070701862 10:78609121-78609143 CAGAATAGCACCAGTTAGAGTGG + Intergenic
1070890999 10:79942191-79942213 CAGAGGAGCCCCAGAAAGCAAGG - Intronic
1075884150 10:125882769-125882791 CAGAATAGCTCCAGGAAGCATGG + Intronic
1075898325 10:126017782-126017804 CAGCACAGCTCCAGAGAACAGGG + Intronic
1076475786 10:130750581-130750603 CAGGACAGCAGCAGAGACCAGGG - Intergenic
1078939824 11:15989921-15989943 CAAAAAAGCACCAGATAGAATGG + Intronic
1081893454 11:46564896-46564918 CAGCAAAGCACCAGAAATCACGG + Intronic
1083586835 11:63865975-63865997 CAGGAACGCACCAGAGAGCAGGG - Intronic
1087332775 11:96802930-96802952 AATGACAGCACCAGATATCAGGG + Intergenic
1087580369 11:100043617-100043639 CAGAACAGTATGAGATAGCAAGG - Intronic
1090078351 11:123593742-123593764 CAGAACAGCAGTAGCTGGCATGG + Intronic
1090097159 11:123753757-123753779 CAGAACAGCCCCGTAGAGCAGGG + Exonic
1090972866 11:131657886-131657908 CAGAACAGAACCACAGGGCAAGG + Intronic
1091382518 12:71466-71488 CAGAACAGCACAAGGTAAAAAGG + Intronic
1091505532 12:1063798-1063820 CAGAATACCACCAAACAGCAAGG - Intronic
1094014922 12:25852078-25852100 CAGAACAGCCCTGGAGAGCAGGG - Intergenic
1094774895 12:33714390-33714412 CAGGACAGAAGCAAATAGCAGGG + Intergenic
1098028225 12:66228151-66228173 CAGAATAGAAGTAGATAGCAAGG - Intronic
1099639065 12:85261234-85261256 GAGAACAGCACTAAAAAGCAGGG - Intronic
1106130175 13:26933276-26933298 CAGAGCAGCACCACCTTGCAGGG + Intergenic
1108453937 13:50594817-50594839 CAGAGCAGCTCCAGGGAGCAGGG - Intronic
1113581243 13:111431038-111431060 CTGAACAGAACCAGAGAGGAAGG - Intergenic
1113749671 13:112768458-112768480 CAGAACAACTCCAGACACCAGGG - Intronic
1114340281 14:21736083-21736105 CAGTACAGCAGCCAATAGCAGGG - Intergenic
1114723862 14:24912706-24912728 CAGAACAGCACCAGATAGCATGG - Intronic
1118255502 14:64201776-64201798 CAGAACTGCACCCCATAGCTGGG - Intronic
1121821759 14:96974407-96974429 CAAACCAGCACCAGCTTGCAGGG - Intergenic
1125148505 15:36502922-36502944 GAGAATAGTACCAGACAGCAGGG - Intergenic
1125368310 15:38942866-38942888 CAGAAGAGAACCAAATACCAAGG + Intergenic
1128230162 15:66029225-66029247 CAGAACACCACAGGGTAGCATGG - Intronic
1129734353 15:77951540-77951562 CAGCCCAGCACCAGATCCCAGGG + Intergenic
1129841233 15:78744451-78744473 CAGCCCAGCACCAGATCCCAGGG - Intergenic
1132945714 16:2530572-2530594 CAGGACAGCACCTGTAAGCAAGG - Exonic
1141707536 16:85675940-85675962 CAAAATAACACCAGTTAGCATGG - Exonic
1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG + Intergenic
1146211203 17:30945127-30945149 GAGCACAGCACCAGTGAGCAGGG - Intronic
1151483037 17:74381338-74381360 CAAAACAGCATCAGCTGGCATGG - Intergenic
1152294828 17:79460800-79460822 CAGACCTGCACCAGATGCCAGGG + Intronic
1152333984 17:79689824-79689846 CAGCACAGCATCACATAGCGAGG - Intergenic
1153431529 18:5022799-5022821 CACAACAGCAACAGATATAAGGG + Intergenic
1156310600 18:35918658-35918680 CAGGACATCAACAGCTAGCAGGG - Intergenic
1161532539 19:4798748-4798770 CAAAACAACACCAGAAAGCAGGG - Exonic
1164969832 19:32522240-32522262 CAGAAAAGCTCCAGGTAGAAAGG + Intergenic
1164988866 19:32670095-32670117 CAGAACAGCAAGAGACAGGAAGG + Intronic
1165682805 19:37791865-37791887 CAGAACTGGCCCAGAAAGCAAGG + Intronic
1167007715 19:46786739-46786761 CAGAAGAGGACCAGTTAGAAAGG - Intronic
928991322 2:37235389-37235411 CAGAACATCACCAGCAGGCAGGG + Intronic
931626817 2:64263619-64263641 CAAAATAGCAACAGAGAGCACGG - Intergenic
936653615 2:114458156-114458178 CAGAATAGCACAGGATAGCCTGG - Intronic
938403605 2:131014811-131014833 CACGACAGCACCAAATAGCCAGG + Intronic
939356167 2:141105865-141105887 CAGAACTACAACAGCTAGCAAGG + Intronic
942978614 2:182050352-182050374 AAGAACGGTACAAGATAGCAAGG - Intronic
948151254 2:235746871-235746893 GAGAACAGAACCTGATCGCAGGG - Intronic
948884697 2:240876863-240876885 GAGAACAGGACCAGACAGCAGGG + Intronic
1168977507 20:1978900-1978922 CAGAACATCATCAGATACCTGGG + Exonic
1170036946 20:11999583-11999605 CAGCACAGCACTAGATAAGAGGG - Intergenic
1170740153 20:19049055-19049077 CAGAACAGCAGCTGTTAGCTTGG + Intergenic
1170747730 20:19115647-19115669 CAGAAGAGCAACAGATGGGAAGG + Intergenic
1172696940 20:36829450-36829472 CAGCACAGCCCCAGAAAGCTGGG + Intronic
1172997650 20:39083053-39083075 CAGAACAGGACCAAGTGGCAGGG - Intergenic
1174719472 20:52796594-52796616 CAGAGCATCACCTGTTAGCAGGG - Intergenic
1175070141 20:56326122-56326144 CTGAACAGCCTCAGAGAGCAGGG + Intergenic
1175553615 20:59832484-59832506 CAGACCCCCACCAGATACCAAGG - Intronic
1176282687 20:64323369-64323391 CAGAACAGCACAAGGTAAAAAGG - Intergenic
1176649240 21:9530412-9530434 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1179161072 21:38899893-38899915 CAGAACTACACCAGATAACATGG - Intergenic
1184347149 22:43920795-43920817 CAAAACATCATCAGATGGCATGG - Intergenic
1185076928 22:48688411-48688433 CAGATCAGCACTGAATAGCAAGG + Intronic
1185113901 22:48920299-48920321 CAGCACAGCACCAGAGACCCTGG - Intergenic
949746746 3:7303337-7303359 GAGAACAGAACCAGGAAGCATGG - Intronic
950087551 3:10271002-10271024 CAGAACAGCACAAGGTAACAAGG + Exonic
950096664 3:10334678-10334700 CAGGACAGAAGCAGAAAGCAGGG - Intronic
950175879 3:10873743-10873765 CAGGACAGGACAGGATAGCATGG - Intronic
950657373 3:14444961-14444983 CAGAAAAGCACCAGCTAGGAAGG - Intronic
951412013 3:22377235-22377257 TAGAACATCACCAGAAAGAAAGG - Intergenic
952006621 3:28848734-28848756 CAGAAAAGCTCCAGAGAGCTAGG + Intergenic
954518024 3:51197671-51197693 GAGAACAGCACCAGCCATCATGG + Intronic
955308797 3:57863086-57863108 CAGCACAGCACTAAATAGCTGGG - Intronic
956809138 3:72847644-72847666 CAGAAGAGCAGCAGACAGCAGGG + Intronic
961104119 3:124226868-124226890 GAGAGCAGAACCAGATACCATGG - Intronic
965111277 3:164427073-164427095 CAGAAGAGCACCAGAAACAAGGG - Intergenic
968648619 4:1751727-1751749 CAGAGCAGACCCAGACAGCAGGG + Intergenic
968789241 4:2648032-2648054 GAGAACAGCAACAGAAAACACGG - Intronic
969546338 4:7831632-7831654 CAGACCAGCACCAGCAAGAAGGG + Intronic
969591245 4:8123025-8123047 AAGAGCAGCAGCAGATAGGAAGG - Intronic
969642525 4:8407549-8407571 CAGCAAAGCACCACAAAGCAGGG - Intronic
969725702 4:8916822-8916844 CAGCCCAGGCCCAGATAGCAGGG - Intergenic
970011694 4:11466346-11466368 CAGAAGAACACCCTATAGCAAGG - Intergenic
976886505 4:89991268-89991290 GAGAAAAGCCCCAAATAGCATGG - Intergenic
977479333 4:97555121-97555143 CAGAAAAGCACCATAGAACAAGG - Intronic
978355051 4:107863191-107863213 CAGAAAATCACAACATAGCATGG + Intronic
979969828 4:127120861-127120883 CAGATCAACGCCAGATGGCATGG - Intergenic
985031654 4:185796323-185796345 CAGACCAGAGCCAGATGGCAGGG - Intronic
986737615 5:10679798-10679820 GAGAACAGCACCAGAAAGGCTGG + Exonic
988077700 5:26373602-26373624 CAGTGCAGCACCAGAATGCAGGG - Intergenic
988626879 5:32886497-32886519 TGGAAAAGCACCAGATAGGAAGG + Intergenic
988839147 5:35066164-35066186 ATGAACAGCACCACTTAGCAGGG - Intronic
988942792 5:36162975-36162997 CAGAACAGCATCAAATTACAGGG + Intronic
989645945 5:43632744-43632766 CTGAACATTACCAGACAGCAGGG - Intronic
990170192 5:53039250-53039272 CAAAATAGCACCTTATAGCAAGG - Intronic
998056067 5:139078536-139078558 CAGAACAGCAGGAGAAGGCAAGG + Intronic
998767494 5:145504172-145504194 TGGAACAGCACAAGCTAGCAGGG + Intronic
1000965568 5:167652057-167652079 AAGAAGAGCATAAGATAGCAAGG - Intronic
1001772015 5:174303827-174303849 CAGAACAGGACCAGCACGCAGGG - Intergenic
1004141116 6:13018561-13018583 CAGAGCAGCACAGTATAGCAGGG - Intronic
1004397409 6:15257939-15257961 CAGAACAGCTCCAGAAGGGAAGG + Intronic
1006375049 6:33667399-33667421 CAGTAGGGCACCAGACAGCAGGG + Intronic
1007267039 6:40604348-40604370 CAGAACATCATCACAGAGCAGGG + Intergenic
1012556323 6:100517057-100517079 CATACCAGCAGCAGATGGCATGG - Intronic
1014110880 6:117617521-117617543 AAGCACAGCACCAAACAGCAAGG + Intergenic
1016902060 6:149113053-149113075 CTGAGCAGCACCAAAGAGCATGG - Intergenic
1017715823 6:157212296-157212318 CAAACCAGGACCAGAAAGCAAGG - Intergenic
1020591523 7:10144989-10145011 CAGAAAAGCATCAGATGGCTGGG - Intergenic
1022235124 7:28453726-28453748 TAGAACAGCAGCACATAGTAGGG - Intronic
1022720207 7:32935893-32935915 CAGAAGAGCAAGAGAGAGCATGG + Intergenic
1025275778 7:57580467-57580489 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1027196777 7:76036061-76036083 CAGAATAGCACCAAATGGGATGG - Intronic
1028691077 7:93651760-93651782 CAGGACAGCACCATATATGAGGG + Intronic
1028883804 7:95909654-95909676 AAAAAGAGCACCAGATACCACGG - Intronic
1030128378 7:106176721-106176743 CAGCTCAGCACAAGACAGCAGGG + Intergenic
1033253610 7:139779999-139780021 CAAAACAGCCCGAGATAGCGTGG + Intronic
1033726815 7:144127839-144127861 CAGAACAGCACCAGGTCACATGG + Intergenic
1035985488 8:4427044-4427066 CGGAACAGCCCCAGAGAGCTTGG + Intronic
1036397526 8:8381780-8381802 CAAAACTGCACCAGAGAGCCGGG - Exonic
1036954895 8:13177133-13177155 CAGAACAGAACCAAATATTATGG + Intronic
1041165803 8:55091037-55091059 CAGCCCAGGACTAGATAGCATGG - Intergenic
1041374001 8:57193705-57193727 CAGCCCAGCACCAGAGAGCAAGG - Intergenic
1041384144 8:57280457-57280479 CGGCCCAGCACCAGAAAGCAAGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG + Exonic
1045170068 8:99655698-99655720 CCTAACAGCACCTGAAAGCAGGG - Intronic
1047950136 8:129925670-129925692 CAGCACAGCAAAAGAAAGCAAGG - Intronic
1048773078 8:137916386-137916408 CACAACAGCAGCATCTAGCAAGG - Intergenic
1048916333 8:139187509-139187531 TAGAACAGAACCAGAGAGCCTGG + Intergenic
1050169400 9:2799558-2799580 CAAAACAGCAGCAGTTAGTAGGG - Intronic
1055043428 9:71899977-71899999 CAGAACAGTATCAGATAGGCAGG + Intronic
1056868036 9:90248067-90248089 CAGAAAAGAACAAGAAAGCATGG - Intergenic
1057571828 9:96210033-96210055 CAGAGCAGCTCCACATGGCAGGG + Intergenic
1057868698 9:98701788-98701810 CAACACAGCACCAGAAAACAAGG + Intronic
1059231347 9:112724451-112724473 CAGAAGAGCAGAAGAGAGCAAGG + Intergenic
1062049723 9:134441021-134441043 CAGCCCAGCCCCAGACAGCATGG - Intergenic
1203626979 Un_KI270750v1:33960-33982 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1186909283 X:14144194-14144216 CAGAACAGCTCCAGCTTCCAGGG + Intergenic
1188912966 X:35872873-35872895 AAGGACAGCACCAAAGAGCATGG - Intergenic
1189251527 X:39604027-39604049 GAGCACAGCACCAGAGAGAAAGG + Intergenic
1193963045 X:87948759-87948781 CAGAACAGCACCATATAATGGGG + Intergenic
1194618471 X:96137416-96137438 GAGAACAGCACCAAGTAGGATGG - Intergenic
1198133385 X:133722400-133722422 CAGGATACCACCACATAGCACGG + Intronic
1199514882 X:148665033-148665055 GGGAACAGCAGCAGATACCAGGG - Intronic