ID: 1114725120

View in Genome Browser
Species Human (GRCh38)
Location 14:24928241-24928263
Sequence TGGCTCCCCCAGCACTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114725120 Original CRISPR TGGCTCCCCCAGCACTACCA TGG Intronic
902961794 1:19968794-19968816 TGGTTCCCACACCACTACCTGGG - Intergenic
903336468 1:22627685-22627707 TGGCTCCCACATCATCACCATGG - Intergenic
904160282 1:28518107-28518129 GGGCTCCCCCAGCCCGGCCAAGG + Intronic
906607048 1:47180003-47180025 TGGCCACCCCTGCACTGCCAGGG + Intergenic
908267999 1:62397221-62397243 AGGCTATCCCAGCACTGCCAAGG + Intergenic
910849337 1:91635568-91635590 TGGCTCTCCCAGCACCCCAAAGG + Intergenic
915105678 1:153533907-153533929 TGACTCACCCGGCACTTCCACGG - Intergenic
915525154 1:156471585-156471607 TGGCTCCCCAAGGAGGACCATGG + Intronic
916151949 1:161802128-161802150 TGACTCCCCCAGCAACAGCAAGG - Exonic
916599239 1:166276148-166276170 TGGGTCCCCCAGGACTTCCTGGG + Intergenic
917737280 1:177932643-177932665 TGGTCCCCTCAGCACTCCCAAGG - Intronic
920216212 1:204363133-204363155 TGGCTCCCCCGCCCCTCCCAGGG + Intronic
921948404 1:220904905-220904927 TGGGCTCACCAGCACTACCACGG - Intergenic
922546859 1:226464364-226464386 CGGGTCCCCCAGCACTGCCCTGG + Intergenic
1063096231 10:2911396-2911418 GGGCTCCCCCAGGAATACCCTGG - Intergenic
1065867257 10:29925098-29925120 GGGCACCCCCATCACTACCTGGG + Intergenic
1069559564 10:69419936-69419958 TGGCACCCCCAGCATTGCCCTGG - Intergenic
1073006564 10:100329708-100329730 TGGGTCATGCAGCACTACCATGG + Intronic
1073471894 10:103727639-103727661 TGGCTCACCCAGCCCTGGCAGGG + Intronic
1075958565 10:126546524-126546546 TGGCTTCCCCTGAACTACCCTGG - Intronic
1081596711 11:44464304-44464326 TGGCTTCTCCAGCCCTACCCTGG + Intergenic
1081666382 11:44919238-44919260 GAGCTCACCAAGCACTACCAGGG + Exonic
1082299410 11:50488282-50488304 GGTCTCCCACAGCACTCCCAGGG - Intergenic
1083214550 11:61210233-61210255 TGGGTCCCCCAGCTCTCCCCAGG - Intronic
1083217434 11:61229062-61229084 TGGGTCCCCCAGCTCTCCCCAGG - Intronic
1083220426 11:61248812-61248834 TGGGTCCCCCAGCTCTCCCCAGG - Intronic
1085252534 11:75153037-75153059 TGGCTGCCCCAGCACTTGCAGGG - Intronic
1085512528 11:77095608-77095630 TTGCTCCCCCAGACCTCCCAGGG + Intronic
1085837675 11:79974075-79974097 AGGCCCCCACAGCACTAGCAGGG + Intergenic
1090649519 11:128793914-128793936 TGACTCCTCCCGCACTGCCAAGG + Intronic
1091221815 11:133934277-133934299 TGGCTCCTCCTGCCCCACCATGG + Intronic
1095702083 12:45201012-45201034 TGCCTCCACCAGGACTGCCAGGG + Intergenic
1096758592 12:53820610-53820632 TGGCTCCCCCTACACTTTCACGG - Intergenic
1098714335 12:73810617-73810639 TCTCTCCCCCACCACTGCCAAGG - Intergenic
1098903559 12:76138244-76138266 TGGATCCGCCAACATTACCAAGG - Intergenic
1099094066 12:78351234-78351256 TGGCTACCCCATCACTAAAAAGG - Intergenic
1102965150 12:117119995-117120017 TGGCTCCCCCAGCAGTGTCCAGG - Intergenic
1103003182 12:117401608-117401630 TGACTTCCCCAACACTACCCAGG - Intronic
1107604820 13:42047741-42047763 TGGCTCTGCCAGGACTTCCAAGG + Intronic
1109537649 13:63739585-63739607 TGCCTCCCCCACCACTGCGATGG + Intergenic
1110144847 13:72178167-72178189 TGGCTCCCCTACATCTACCAGGG - Intergenic
1110450947 13:75636656-75636678 TGCCTCCTCCAGCCCTTCCATGG - Intronic
1111945569 13:94661558-94661580 CGGCTCCCTCAGCAGTTCCAAGG + Intergenic
1112025241 13:95405622-95405644 TAGCTCCCAGAGCACCACCAAGG - Intergenic
1113656169 13:112068766-112068788 TCGCTGCCGCAGCACTACCAGGG + Exonic
1114460535 14:22883592-22883614 CCCCTCCCCCAGCACTCCCAGGG + Intronic
1114725120 14:24928241-24928263 TGGCTCCCCCAGCACTACCATGG + Intronic
1117466675 14:56001047-56001069 TGGCTGCCTTAGCACTACCAAGG - Intergenic
1118079200 14:62338865-62338887 TGTGTCTCCCAGCGCTACCATGG + Intergenic
1121711815 14:96044075-96044097 TGGCCCCCCCAGCTCTTGCAGGG - Intronic
1122789486 14:104178336-104178358 GGGCGCCCCCACCACCACCAGGG - Intronic
1125833477 15:42731792-42731814 CGGTGCCCCCAGCACCACCAGGG + Exonic
1131846112 15:96492031-96492053 TGGGTCCCCCAGCAGTGCCGGGG - Intergenic
1136001957 16:27301459-27301481 TGGCTGCCTTAGCAATACCATGG - Intergenic
1138559061 16:57789167-57789189 TGGGACCCCCAGGACTGCCAAGG + Intronic
1139651077 16:68362349-68362371 TGGATCCCCTAGCACCATCATGG - Intronic
1141537151 16:84689982-84690004 TAGTTCACCCAGCACTTCCAAGG - Intergenic
1145269078 17:21394898-21394920 GGGGTCCCTCAGCACTTCCAGGG - Intronic
1146786541 17:35726520-35726542 TGACTGCCCCAGCCCTCCCAGGG + Intronic
1147498009 17:40936480-40936502 GGGCTCCCCCCGCACCGCCATGG + Exonic
1147502209 17:40976351-40976373 TCCCTCCTCCAGCAGTACCAAGG - Intergenic
1147634495 17:41955126-41955148 TGGCTACTCGAGCACTGCCAGGG - Intronic
1148274066 17:46288017-46288039 TGGCACTCCTAGCTCTACCAAGG + Intronic
1148912275 17:50949422-50949444 GGCCTCCCCCAGCACCCCCAAGG + Intergenic
1150408988 17:64926560-64926582 TGGCACTCCTAGCTCTACCAAGG - Intergenic
1151557540 17:74854279-74854301 TGCCTCCCCCAGGGCTCCCAGGG + Intronic
1151739992 17:75974694-75974716 AGGGTCCCCCAGCACTGCAATGG - Intronic
1152080956 17:78186940-78186962 TGGCTCCCCCAGCAAGACCCGGG - Exonic
1152153810 17:78619605-78619627 TGTCTCCCCCAGCAGTGCAAGGG + Intergenic
1156607155 18:38679994-38680016 TGGCTCCCACAACAGCACCAAGG + Intergenic
1158110935 18:53940949-53940971 TGGCTCCTGCAGCCCTCCCATGG - Intergenic
1160202759 18:76808952-76808974 TAGCAGCCCCAGCATTACCAAGG - Intronic
1160222104 18:76985068-76985090 CTGCTCCCCCAGGTCTACCAGGG + Intronic
1160822528 19:1065184-1065206 TGCCTCCCCCAGCCCGACCCCGG - Intronic
1161028872 19:2048859-2048881 TGGCTGCCCCAGGGCCACCAGGG - Intronic
1161740510 19:6018386-6018408 TGGCCCCTCCAGCCCTAACAGGG + Intronic
1164608025 19:29613816-29613838 TGGTTCCCCCAGCACCACAGAGG + Intronic
1164628844 19:29747727-29747749 TGGCCTCCCCAGCACTGACAGGG + Intergenic
1165136033 19:33669606-33669628 TGTCTCCTCCAGGACTGCCAGGG - Intronic
1166846851 19:45733708-45733730 GGCCTCCCCCAGCACTAGCTGGG + Intronic
1166864528 19:45827888-45827910 TGGCGCCTCCAGCACAACCTTGG + Exonic
925304852 2:2840833-2840855 TGGCTGCTCCAGAACTGCCATGG + Intergenic
925913207 2:8586731-8586753 TGGCTCCCTCAGATCTACCATGG - Intergenic
926929395 2:18022452-18022474 TGGCTCCTCCAGCCCAACCAAGG - Intronic
929332864 2:40704936-40704958 TGACTTCCCCAGTACTGCCATGG - Intergenic
929554746 2:42919066-42919088 TGCCTCCCCAAGAACTACCCAGG - Intergenic
936087684 2:109480474-109480496 TGGCACCCTCAGGACTAACAGGG - Intronic
942326999 2:174784402-174784424 TGGCAACCTCAGCACGACCAAGG - Intergenic
948375013 2:237515651-237515673 TGCATCCCCCACAACTACCAGGG + Intronic
949065587 2:241988336-241988358 TGGCCTCCCCAGCACAGCCAGGG + Intergenic
1168836976 20:884004-884026 TGGCGCTCCCGGCACCACCAGGG - Intronic
1170134555 20:13058563-13058585 TGCCTCACCCCCCACTACCAAGG - Intronic
1173475137 20:43353478-43353500 TGGCTCCCCCTGCATCTCCAAGG + Intergenic
1174367684 20:50066385-50066407 TGGGGCCACCAACACTACCAAGG + Intergenic
1174950367 20:55035623-55035645 TGGATCAGCCAGCAGTACCAAGG + Intergenic
1176679941 21:9813997-9814019 TGGATACCCAAGCACTGCCACGG + Intergenic
1176680223 21:9815406-9815428 TGGATACCCAAGCACTGCCACGG + Intergenic
1177644527 21:23884836-23884858 TCGCTTCTCCAGAACTACCACGG + Intergenic
1183333231 22:37232462-37232484 CCCCTCCCCCAGCACTCCCAGGG + Intronic
1184184609 22:42856695-42856717 CGGCTCCCCCAGCGCCACCCTGG - Intronic
949991361 3:9581939-9581961 TGGCTCCCCCAGCACCTTAAAGG - Intergenic
951755300 3:26084803-26084825 TGCCTCCTCCTGCTCTACCAAGG + Intergenic
952510772 3:34052670-34052692 TGGCTCCCCTAGGCCCACCAGGG - Intergenic
953683338 3:45056784-45056806 TTACACCCCCAGCACTAGCATGG - Intergenic
954420887 3:50418521-50418543 TGTCTCCCTGAGCACTCCCAGGG + Intronic
954754455 3:52831668-52831690 TGGCTTCCCCAGAGCCACCAGGG - Intronic
954974423 3:54679467-54679489 TTGCTGCCCCAGCTCTCCCAGGG - Intronic
955839882 3:63100935-63100957 TTCCTCCCCCAATACTACCAGGG + Intergenic
960163716 3:114378428-114378450 TGGCTTCCCCAGGGCCACCAAGG + Intronic
961500190 3:127326879-127326901 TGGCCCACCCAGCACTGTCATGG + Intergenic
968648304 4:1750538-1750560 TGGCCTCCCCAGCACTGCCCTGG - Intergenic
969668684 4:8577137-8577159 GGGCTCCCCCAGCCCCTCCAAGG + Intronic
970142362 4:12996437-12996459 AGGAGCCCCCAGCACCACCAGGG + Intergenic
971116487 4:23652279-23652301 GGGCTCCTCCTGAACTACCATGG - Intergenic
971125509 4:23749793-23749815 AGGCTCACCCTGCACTAGCATGG - Intergenic
971153370 4:24057609-24057631 TACCTCCTCCACCACTACCAAGG - Intergenic
973531517 4:51841695-51841717 TGTGTCCCACAGCACTCCCATGG - Intergenic
974499740 4:62684397-62684419 TGGATTCCTCAGCACTAACAGGG - Intergenic
975327536 4:73077029-73077051 TGGGTCCTCCAGCACCATCAGGG + Exonic
976841563 4:89438242-89438264 CCGCTTCCCCAGCACTGCCAAGG - Intergenic
980095375 4:128484608-128484630 TGGCCTCACCAGCATTACCAGGG - Intergenic
985289925 4:188376913-188376935 TGACTCCCCCACCAGTGCCAAGG + Intergenic
985614108 5:909268-909290 TGGCTCGCCCATCACTTCCTTGG - Intronic
986294149 5:6423426-6423448 TGCCTCCCACAGCCCTGCCATGG - Intergenic
987911300 5:24149697-24149719 TTGGTCACCCAGCACTATCATGG - Intronic
989123244 5:38025834-38025856 TGGCTCCCCCATCTCAACAAAGG - Intergenic
990471527 5:56120566-56120588 TGGCTCCCCCAGCACTGGAAAGG + Intronic
1000999313 5:167990567-167990589 TGGCACGACCAGGACTACCAAGG + Intronic
1001729014 5:173934501-173934523 TGGCTCCCCAAGCAAGACCCGGG + Intronic
1001788084 5:174431092-174431114 GGGCCCTCCCAGCTCTACCAGGG - Intergenic
1004237983 6:13891859-13891881 TGGCTGCCTCAGCACTGCAATGG - Intergenic
1005850504 6:29817266-29817288 TGACTCTCCCAGCCCTACCAAGG + Intergenic
1006906230 6:37535658-37535680 CCCCTCCCCCAGCTCTACCAGGG - Intergenic
1007299229 6:40853789-40853811 AGGCTCCCCCAGGTCAACCAGGG - Intergenic
1007530157 6:42534984-42535006 CTGCTACCCCAGCATTACCAGGG - Intergenic
1011714670 6:90092878-90092900 AGGCACTCCCATCACTACCATGG - Intronic
1011935039 6:92766182-92766204 TGGCTCCCCCAGGTTTACCAAGG + Intergenic
1013375258 6:109508667-109508689 TTGCTCCTCCAGCACAGCCACGG - Intronic
1013468216 6:110436252-110436274 TGGTGCCACCAGCACTATCAGGG - Intronic
1019604643 7:1902370-1902392 TGGCTCTCCCTGCCCTGCCAAGG - Intronic
1019999087 7:4744732-4744754 TGGCTCCCGCAGCAAGAGCAGGG - Intronic
1022963686 7:35454148-35454170 TGCCTCCACCACCCCTACCAGGG + Intergenic
1024428806 7:49262082-49262104 CGGCACCCCCAGCAATACCAGGG + Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1031424040 7:121584432-121584454 TAGATCCCCCAGCACTCCTAGGG + Intergenic
1034151779 7:148922500-148922522 CGGCTCACCCAGCACTACCCCGG + Intergenic
1034739000 7:153456070-153456092 TGGCTGCCTCACCACTGCCACGG + Intergenic
1036915321 8:12799032-12799054 TGGATCCCCCAGGCCTGCCAAGG + Intergenic
1037433725 8:18841326-18841348 GGGCCTCCCCAGCACTCCCAAGG - Intronic
1038379770 8:27081690-27081712 TGCTTCCCCCATCTCTACCAGGG + Intergenic
1040869291 8:52083720-52083742 TGCCTTCACCAGCACTCCCAAGG + Intergenic
1045486902 8:102638610-102638632 TGTCTCCTCCAGCTCAACCATGG + Intergenic
1047251142 8:123182824-123182846 AGCCTCCCCCAGCACCACCCAGG + Exonic
1047632228 8:126720963-126720985 TGGCTGCTTCAGCACTACAATGG + Intergenic
1048164907 8:132053891-132053913 TGGCTCCCTCAACACAGCCAGGG - Intronic
1048845175 8:138598779-138598801 TGGGTCCCCAAGGACTACCTGGG - Exonic
1050367745 9:4888096-4888118 TGGCCCCCACAGCACTACAGGGG + Intergenic
1050806284 9:9682613-9682635 TGTCTCCCTAAGCACTTCCAAGG - Intronic
1056303581 9:85267786-85267808 GGGCTCCCCCAACCCCACCAGGG - Intergenic
1057819782 9:98322065-98322087 TTGCTCCCCCATCATTTCCAGGG + Intronic
1059353617 9:113683466-113683488 AGGCTCCCCCAGCCCCACCACGG + Intergenic
1060983743 9:127808274-127808296 TCGGTCCCTCAGCACTGCCAGGG - Exonic
1061154820 9:128851925-128851947 TGCCTCCCCCAGCACTCACTCGG - Intronic
1061193581 9:129095652-129095674 TGACGCCCCCAGCACTTCCCAGG + Intronic
1062005166 9:134235259-134235281 TGGCTCCCAGGGCACTGCCATGG - Intergenic
1062096987 9:134708591-134708613 GGGCTGCCTCAGCACTGCCAGGG - Intronic
1062403659 9:136383362-136383384 TGCCTCCCTCAGCCCTCCCAAGG - Exonic
1203666243 Un_KI270754v1:22167-22189 TGGATACCCAAGCACTGCCACGG + Intergenic
1203667392 Un_KI270754v1:27806-27828 TGGATACCCAAGCACTGCCACGG + Intergenic
1203668540 Un_KI270754v1:33445-33467 TGGATACCCAAGCACTGCCACGG + Intergenic
1203669384 Un_KI270754v1:37671-37693 TGGATACCCAAGCACTGCCACGG + Intergenic
1189701387 X:43718283-43718305 TGTCTCCCCCACTACTACCCAGG - Intronic
1190469432 X:50763511-50763533 TAGCTTTCCCACCACTACCATGG + Intronic
1195896364 X:109749514-109749536 TGGGTCCCCCAGCAGTGCCGGGG - Intergenic
1196755137 X:119150968-119150990 CGGCTCCCTCAGCAGCACCATGG - Intergenic
1197226562 X:123961140-123961162 TCGCTACCCCAACACTTCCAAGG + Intronic