ID: 1114727603

View in Genome Browser
Species Human (GRCh38)
Location 14:24955329-24955351
Sequence GAATGTGGATGAGTGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114727603 Original CRISPR GAATGTGGATGAGTGGCCTG TGG (reversed) Intronic
900563870 1:3322897-3322919 GGATGTGGTTCAGTGGACTGGGG + Intronic
902308378 1:15561309-15561331 GAATGAGGCTCAGTGGCCTCTGG + Intronic
902619483 1:17642575-17642597 GAATGGGGAGGGGTTGCCTGTGG + Intronic
903366446 1:22808215-22808237 CATTGTGGATGAGGGGACTGAGG + Intronic
903701728 1:25253765-25253787 GCTTGTGGATTAGGGGCCTGTGG - Intronic
903705362 1:25281642-25281664 GAATGGGGGTGTGTGGCCAGGGG - Intronic
904004676 1:27357510-27357532 GAGTGTGGATGTGTGCCCCGAGG + Exonic
905127719 1:35727235-35727257 GAATGAGCAGGAGTGGCCAGAGG + Intronic
906195435 1:43927731-43927753 GAATGGGGATGAGTCGCCCAGGG + Intronic
907859231 1:58335314-58335336 GAGGGTGGAGGAGTGGCCTGGGG + Intronic
908265710 1:62377366-62377388 GAATGAGGATGTGTGGCGTGGGG + Intergenic
912746323 1:112248451-112248473 GATTGTCCATGAGCGGCCTGTGG - Intergenic
912781860 1:112557719-112557741 GAATGTGGATGAGTGGACTGGGG + Intronic
915042203 1:152977961-152977983 GAATGTGGGTGTTTGGCCTGAGG - Intergenic
915342865 1:155185758-155185780 GAATGTGTGTGAGGGGGCTGGGG - Intronic
915489295 1:156242493-156242515 GAAGGAGGATGAGGGCCCTGGGG + Intronic
915500829 1:156316057-156316079 GAATCTGGATGCGGGACCTGCGG - Intronic
915563167 1:156699411-156699433 GAATGTGGAGGTGAGGCTTGTGG + Intergenic
917700710 1:177577975-177577997 GAAGGAGGATGAGTGACATGTGG - Intergenic
917713563 1:177711237-177711259 GAAAGAGGCTCAGTGGCCTGTGG + Intergenic
917868140 1:179217391-179217413 CAAGGTGGATGAGTCACCTGAGG + Intronic
917972554 1:180218209-180218231 GCCTGTGGATCAGGGGCCTGTGG + Intergenic
920671972 1:208010679-208010701 GAATGTGGATCAGTGACCTTGGG - Intergenic
921293339 1:213679015-213679037 GAATGGGTCTCAGTGGCCTGAGG + Intergenic
921906689 1:220502676-220502698 GAATGTGGATGATCAGCCAGGGG - Intergenic
922046300 1:221949228-221949250 GCATGTTGAGGAGTGGCCTTGGG - Intergenic
922717890 1:227886569-227886591 GAAGGTGGGGGAGAGGCCTGGGG - Intergenic
922742216 1:228020411-228020433 GACTGTGGGTGAGAGGCCTCTGG - Intronic
922895253 1:229094982-229095004 AAATGTGGATAAGTGGCTTCGGG - Intergenic
924508802 1:244711477-244711499 GTCTGGGGATGAATGGCCTGGGG - Intergenic
924601743 1:245496266-245496288 GAATCTGGATGAGGGGCATATGG + Intronic
1063282442 10:4645148-4645170 GAATGGGGAGGAGTAGGCTGTGG - Intergenic
1064800418 10:19064341-19064363 GAATGTGGATGTGTGGCATATGG + Intronic
1065478179 10:26163808-26163830 GCATGTAGATGAGATGCCTGTGG + Intronic
1065542813 10:26786785-26786807 GAATGTGGATGAGTTTGCCGAGG - Intronic
1066814042 10:39380027-39380049 GGATATGTCTGAGTGGCCTGAGG - Intergenic
1067577123 10:47415932-47415954 TGTGGTGGATGAGTGGCCTGTGG - Intergenic
1067790711 10:49285476-49285498 GAATGTGGTTGCAGGGCCTGGGG + Intergenic
1068595234 10:58896041-58896063 GAATTTGGAATAGTGGCATGTGG - Intergenic
1069504889 10:68988997-68989019 GGACGAGGATGAGCGGCCTGAGG + Exonic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1072930294 10:99656566-99656588 GAATTTGGAGGAGTGTCATGTGG - Intergenic
1073178102 10:101568869-101568891 GAAAGTGGATGAGGGGCCCAGGG + Intergenic
1074413455 10:113247190-113247212 GAATTTGGAAGAGTGGGCTGGGG - Intergenic
1075131167 10:119741196-119741218 GAATGTGCAAGGGTGACCTGGGG - Intronic
1075997720 10:126892123-126892145 GCATGTGGGTGAGTGGTATGTGG - Intergenic
1076136564 10:128049239-128049261 GTGGGTGGATGAGTGGCCTCGGG + Intronic
1076231416 10:128822834-128822856 GAATGGGGATGGGTGGTTTGGGG - Intergenic
1076237996 10:128880688-128880710 GAATGTGGATGAGATTACTGAGG + Intergenic
1076588058 10:131563484-131563506 GAGTGTGGATCAGTTTCCTGGGG + Intergenic
1076622582 10:131801735-131801757 GCTTGTGGATGTGTGGTCTGTGG - Intergenic
1077638410 11:3859475-3859497 GAATGTGCATGAGGGACCTCAGG + Intronic
1080372815 11:31672043-31672065 GAAGGTCGATGAGGGGGCTGGGG + Intronic
1082871403 11:57946227-57946249 GAAAGTGGATCAGCAGCCTGGGG + Intergenic
1083700630 11:64475488-64475510 GAGGGTGAATGAGTGTCCTGTGG + Intergenic
1083732363 11:64659516-64659538 GAGTCAGCATGAGTGGCCTGAGG + Intronic
1083806780 11:65079160-65079182 GGAGCTGGATGAGTGGGCTGCGG - Exonic
1088511345 11:110578995-110579017 GAATGAGGAATAGGGGCCTGAGG - Exonic
1089808283 11:121111484-121111506 GAATGTGTAAGAGTGAGCTGAGG + Intronic
1090077955 11:123591275-123591297 GACTGTGGATGGGTGGCCTCTGG - Intronic
1093743044 12:22709872-22709894 GAATCTGGATGACTGACCTATGG - Intergenic
1095991106 12:48035168-48035190 GAAAGGGGAGGAGAGGCCTGGGG + Intergenic
1099317328 12:81100724-81100746 GAGTGAGGATGGATGGCCTGGGG - Intronic
1101945272 12:109131542-109131564 GCATGGGGATGAGTGTGCTGTGG + Intronic
1103324820 12:120113439-120113461 AAATGAGGATGGCTGGCCTGAGG + Intronic
1103387066 12:120541393-120541415 GAATGTGGCTGAGTTAGCTGGGG + Intronic
1103795190 12:123498543-123498565 GAATGGGGAGGAGGAGCCTGAGG - Exonic
1103915661 12:124374386-124374408 GAATGTGGCCGGCTGGCCTGGGG - Intronic
1106408201 13:29492310-29492332 GTATGTGTATGTGTGGCATGTGG + Intronic
1107656649 13:42598484-42598506 GCAGGTGGATGGGTGGCCTTAGG - Intronic
1110528655 13:76570944-76570966 GATTGTGGACCAGTGGCCAGAGG + Intergenic
1112403739 13:99099492-99099514 GTATGTGAATGAGTGAACTGAGG - Intergenic
1112950154 13:104984683-104984705 GTATTTGGAAGAGTAGCCTGGGG + Intergenic
1113130744 13:107034470-107034492 GAATATGGAAGAGTAGCCAGTGG - Intergenic
1113995830 14:16069199-16069221 GAATATTTATGAGTGGCTTGAGG + Intergenic
1114727603 14:24955329-24955351 GAATGTGGATGAGTGGCCTGTGG - Intronic
1116858658 14:49976147-49976169 GAATGTGGGTGTGAGGCTTGTGG + Intergenic
1116940769 14:50788781-50788803 GATTGTGGAGGAGTGGGCAGTGG - Intronic
1117243233 14:53856789-53856811 GAATGTGAATGTATTGCCTGAGG - Intergenic
1118323797 14:64768472-64768494 GATGCTGGATGAGTGGCCAGGGG + Intronic
1119998533 14:79278754-79278776 GAAGGTGGAGCGGTGGCCTGGGG - Intronic
1121584917 14:95056718-95056740 AAAGGTGGATGAGTGCCCTGGGG - Intergenic
1121591677 14:95118401-95118423 GAATTTTGGTCAGTGGCCTGGGG - Intronic
1121991839 14:98565411-98565433 TAATGAAGAAGAGTGGCCTGGGG + Intergenic
1122409417 14:101518344-101518366 GAAAGGGCATGTGTGGCCTGGGG + Intergenic
1122932378 14:104940168-104940190 GAATGTGGACCTGTGGCCGGTGG + Exonic
1124841928 15:33250251-33250273 GACTGTGGATAGGTGTCCTGGGG - Intergenic
1125235798 15:37512128-37512150 GAGTGTGGAACAGTGGTCTGTGG - Intergenic
1125713562 15:41805968-41805990 GAGTGTGAATGAGGGCCCTGGGG - Intronic
1125795603 15:42402065-42402087 GAATGAGGATGAGGAGCCTGCGG - Intronic
1126418624 15:48446792-48446814 GAATGTGAAAGAGATGCCTGTGG - Exonic
1128137640 15:65275796-65275818 GAAGGGGGATGAGTGCCCTTTGG - Intronic
1128545211 15:68561942-68561964 GAATGTGGATGAGTAGGGGGAGG + Intergenic
1129297033 15:74605114-74605136 GCATGTGGACTAGGGGCCTGGGG + Intronic
1130170460 15:81506854-81506876 GGATGTGGATGGGTGCCCAGGGG - Intergenic
1131135092 15:89928282-89928304 GGATGTGGATGACTTGGCTGAGG + Intergenic
1131358380 15:91766372-91766394 GTTTGTGGATGATTTGCCTGGGG - Intergenic
1133792717 16:9021575-9021597 GACTGGTGATGAGTGGCCAGTGG + Intergenic
1136278397 16:29192681-29192703 TAAAGTGGATCTGTGGCCTGTGG + Intergenic
1140904767 16:79400839-79400861 GAATGTTGAGAAATGGCCTGGGG + Intergenic
1142082779 16:88158714-88158736 TAAAGTGGATCTGTGGCCTGTGG + Intergenic
1143637153 17:8171811-8171833 GAGTGTGGATGAGGGAACTGAGG + Intergenic
1144199430 17:12926130-12926152 GAATGAGGGTGGATGGCCTGAGG + Intronic
1145272176 17:21410560-21410582 GAATGAGGGTGAGTGGCCGTGGG + Intronic
1145768214 17:27473889-27473911 GCAGCTGGAAGAGTGGCCTGGGG - Intronic
1146229618 17:31095663-31095685 AAATGGGGATGAGTGACCTGGGG + Intronic
1146288084 17:31588090-31588112 CAATGTGGATGGGTGGCCCTGGG + Intergenic
1147924689 17:43939080-43939102 GAAGGTGGATGGGTTGCCAGGGG - Intergenic
1151247285 17:72804675-72804697 GAAACTGGATGACTGGTCTGAGG - Intronic
1151322883 17:73361987-73362009 CAATGTGGTTGTGTGGGCTGGGG - Intronic
1151882385 17:76903367-76903389 GAAGGTGGAGGTGAGGCCTGGGG + Exonic
1152186572 17:78860474-78860496 AAATGTGGATGGCTTGCCTGGGG + Intronic
1152260553 17:79264604-79264626 GCACGTGGATGAGTCTCCTGGGG - Intronic
1152330281 17:79668831-79668853 GAAGGAGGACCAGTGGCCTGTGG - Intergenic
1203211544 17_KI270730v1_random:83173-83195 GAATGTGGTGGAATGGACTGGGG + Intergenic
1153202918 18:2664088-2664110 GAATCTGGATGAGTACACTGGGG - Intronic
1153296675 18:3552809-3552831 GCATGTGGATGGGTGGCATTGGG - Intronic
1154048390 18:10929721-10929743 GAATGTGTATGCTTGACCTGAGG + Intronic
1156384511 18:36593457-36593479 GAATGTGGATGAATGACTTGGGG + Intronic
1156683338 18:39617109-39617131 GCCTCTGGATCAGTGGCCTGAGG + Intergenic
1156807060 18:41197385-41197407 CAATTTGGATGAGGGGCCTGGGG + Intergenic
1157621523 18:49020100-49020122 AACAGTGGATGTGTGGCCTGGGG - Intergenic
1161468910 19:4446785-4446807 GAATGGGGACGAGGGGCCTCGGG - Intronic
1163581756 19:18143696-18143718 GAAGGTGGCTGAGTATCCTGGGG + Intronic
1165427713 19:35755067-35755089 GATTGTGCCTGACTGGCCTGGGG + Exonic
1166711812 19:44942402-44942424 GAGTGTGGCTGTGTGTCCTGTGG + Intronic
1166811698 19:45518127-45518149 GAATGCGGCTGTGTGGCCTGGGG + Intronic
1166853530 19:45771354-45771376 GAAGGTGGATCCGTGGCCCGGGG + Exonic
1167903235 19:52637807-52637829 GACTGTGGAGGAGAGACCTGTGG + Intronic
1167990716 19:53358348-53358370 GGAAGTGGATAAGTGGCCCGCGG - Intergenic
925390650 2:3491795-3491817 GGAGGTGGCCGAGTGGCCTGTGG - Intergenic
925781504 2:7386295-7386317 CCATGTGCATGAGAGGCCTGCGG - Intergenic
927148144 2:20180267-20180289 GAAAGGGGAGGAGGGGCCTGAGG - Intergenic
927498055 2:23563905-23563927 GAATGTGTTTGGCTGGCCTGGGG - Intronic
927886520 2:26721796-26721818 GAAGGTGGATGAGGGACCTGTGG - Intronic
927948944 2:27154590-27154612 GAATGTGGATGGGAGCCATGGGG + Exonic
929340518 2:40810640-40810662 GAATGTGGGTGAGTAGCAAGTGG + Intergenic
929795165 2:45053631-45053653 CAGTGTGGATGACTGGCCAGTGG + Intergenic
931979536 2:67679701-67679723 GAATGCAGATGAGAGGCCTGAGG - Intergenic
932490351 2:72116131-72116153 AAATGAGCATGTGTGGCCTGAGG - Intergenic
935209192 2:100923801-100923823 GATTGTTGATGAAGGGCCTGTGG + Intronic
935811676 2:106804459-106804481 GAATGTGGGTGAGGTGGCTGTGG - Exonic
937355623 2:121196446-121196468 GAATGTGGGTGTGTGGGCAGGGG - Intergenic
937832465 2:126438379-126438401 GAAAGGGCATGGGTGGCCTGTGG - Intergenic
938648198 2:133352639-133352661 GCATGGGGATGGGTGGACTGAGG + Intronic
938985094 2:136567408-136567430 GAATGAGGATGAGCAGTCTGTGG + Intergenic
941840072 2:170072655-170072677 GAATGGAGCTGAGTGGTCTGAGG + Intronic
942073391 2:172335429-172335451 GAATCTGGGAGAGAGGCCTGGGG - Intergenic
943111531 2:183612160-183612182 GAGGGTGGGTGAGTGGCCTTGGG - Intergenic
945211625 2:207389291-207389313 GAGTCTGGGAGAGTGGCCTGTGG - Intergenic
947705583 2:232273015-232273037 GAAGGTGGAGGAGTAGGCTGGGG - Intronic
948384048 2:237570800-237570822 CAATGTTGATGAGTGGCCCTGGG - Intergenic
948385701 2:237579281-237579303 GACAGTGCATGAGTGTCCTGCGG + Intronic
948544072 2:238713565-238713587 GTATGTGTATGTGTGGCGTGTGG - Intergenic
948726161 2:239935272-239935294 AAATGTGTTTGAGTGGCCTTTGG - Intronic
1168813588 20:721793-721815 GAAAGTGGAAGCTTGGCCTGGGG + Intergenic
1169198014 20:3693672-3693694 GAATGTGCAGGTGTGGCCCGGGG - Exonic
1171179982 20:23085019-23085041 GGATGTGGATGAGTGTGCTCTGG - Exonic
1174271606 20:49373498-49373520 GAACGGGGAGGAGTGGACTGGGG + Exonic
1174442055 20:50563681-50563703 GAATGGGGATAAGTGGTCTGGGG - Intronic
1174581704 20:51576857-51576879 GACTGGGGAGGAGGGGCCTGGGG + Intergenic
1175943197 20:62547324-62547346 GGCAGTGGATGGGTGGCCTGGGG - Intergenic
1175996107 20:62812992-62813014 GAAGGTGGATGAGGGTGCTGGGG + Exonic
1177361270 21:20075406-20075428 GAATTTGGGTGGCTGGCCTGTGG + Intergenic
1177946248 21:27472836-27472858 AAAGGTGGCTGAGTGGCCTGTGG + Intergenic
1178185546 21:30215758-30215780 GACTGTGGATGAATTGCGTGAGG - Exonic
1178313826 21:31553201-31553223 GCATGAGGAGGAGTGTCCTGGGG + Intronic
1178594784 21:33943294-33943316 AAATGTGGATCACTGGCCAGGGG - Intergenic
1178830667 21:36053988-36054010 TAATGGGGATAAGTGGCCTGGGG - Intronic
1179006792 21:37522288-37522310 GAATGTGCATGAATGACCTGGGG - Intergenic
1179942953 21:44651346-44651368 GAAGTTGGATGTGTGTCCTGTGG + Intronic
1180311229 22:11237947-11237969 GAATATTTATGAGTGGCTTGAGG - Intergenic
1180971822 22:19819926-19819948 GATGGTGGCTGAGTGGCCAGGGG - Intronic
1181176222 22:21038040-21038062 GAATGTGGCCATGTGGCCTGAGG - Intergenic
1181621719 22:24095854-24095876 CAGTGTGGCTGACTGGCCTGTGG + Intronic
1181991947 22:26843756-26843778 GAGTGTGCAAGAGTTGCCTGGGG + Intergenic
1183019403 22:35015131-35015153 GAAACTGGATGATAGGCCTGGGG + Intergenic
1183108398 22:35630603-35630625 GAATGTGGATGTGTGGGTCGGGG - Intronic
1183722445 22:39570596-39570618 GAGTGAGGGTGAGGGGCCTGTGG + Intergenic
1184177340 22:42795824-42795846 GAAGGGGGATGAGGAGCCTGAGG + Intergenic
1184281684 22:43440980-43441002 GAAGGTGGGTGAGAGGCCTAAGG - Intronic
1184995048 22:48199278-48199300 GACAGTGGAAGAGGGGCCTGGGG + Intergenic
1185322001 22:50205786-50205808 AGAAGTGGCTGAGTGGCCTGAGG + Intronic
1203299661 22_KI270736v1_random:68173-68195 GAATGTGAAGGAGTGGAGTGGGG + Intergenic
950010801 3:9722377-9722399 GAAAATGGGTGAGTGGCCAGAGG - Intronic
952570355 3:34708670-34708692 AAATGTGGATCAGTGGGGTGTGG - Intergenic
952902806 3:38121073-38121095 GAGTGTGAAGGAGTGGCCTGGGG + Intronic
952927110 3:38328441-38328463 GAGTGTGAAGGAGTGGCCTAGGG - Intergenic
952990748 3:38829009-38829031 GAATGAGGATGGCTGGGCTGGGG + Intergenic
957518071 3:81281826-81281848 GAATGTGGTTAAGTGACTTGTGG - Intergenic
957741124 3:84270070-84270092 AAATGTGGATGAGAGGTCAGGGG - Intergenic
959263203 3:104105856-104105878 ACATGTGAATGAGTGGGCTGGGG - Intergenic
959477133 3:106824560-106824582 GAATGTTGAAGTTTGGCCTGTGG - Intergenic
959582814 3:107999577-107999599 GAATGTTGAGGTTTGGCCTGTGG + Intergenic
961019950 3:123497041-123497063 GAATGTGGATGGGAGGCCAAGGG + Intronic
962645971 3:137440716-137440738 AAATGTGGCAGAGTGGCATGGGG + Intergenic
963067289 3:141273904-141273926 GAATCTAAATGAGTGTCCTGGGG - Intronic
963636288 3:147801058-147801080 GTATTTGGATGTGGGGCCTGTGG + Intergenic
963846978 3:150169258-150169280 GAATTTGATTGAGTGGCCTTGGG - Intergenic
966941751 3:184752395-184752417 GTATTTGGATGAATGGCCTGTGG + Intergenic
968452147 4:680809-680831 GAAGATGGAGGAGTGGGCTGAGG - Intronic
968770583 4:2503384-2503406 GAAAGTGGATGGGTGGCCAGAGG + Intronic
969325648 4:6442333-6442355 GGAGGTGGGTGAGTGGCCAGAGG + Intronic
969560093 4:7941312-7941334 GAATGTGGATGAGCAGGTTGGGG - Intergenic
970371285 4:15409301-15409323 TAATTTGGATGAAGGGCCTGAGG - Intronic
970419271 4:15890059-15890081 CAATGTGGATAAGAGGCCGGAGG + Intergenic
974009648 4:56595026-56595048 GAATGAGGATGCCTGTCCTGTGG + Intronic
974242943 4:59274668-59274690 GGATGGGCATGATTGGCCTGCGG + Intergenic
975980926 4:80158312-80158334 GCATGTGGAACAGAGGCCTGAGG - Intergenic
977454348 4:97239021-97239043 GAAGGTGGAGGAGTAGACTGAGG + Intronic
978822324 4:112980103-112980125 GAGTGTGGAAGAGGGGCCAGGGG - Intronic
979832908 4:125322536-125322558 GAATGTCTTTGAGGGGCCTGGGG - Intronic
981482878 4:145256072-145256094 GAAGGTGGGTGAGTGGCCCTGGG + Intergenic
981673387 4:147313127-147313149 GAATCTGGCTGAGTGGTCTTAGG - Intergenic
982868609 4:160548959-160548981 GTGTGTGGATGTGTGGTCTGGGG + Intergenic
985479257 5:97472-97494 GAAAGCAGATGAGTTGCCTGGGG - Intergenic
985671759 5:1210377-1210399 GAGTGGGGATGGGTGGCCAGTGG + Intronic
985730519 5:1544827-1544849 CACTGTGGATGAGTTGCCAGTGG + Intergenic
986227538 5:5829459-5829481 GACTGTGGCTGAGTGCCATGGGG - Intergenic
986318919 5:6611939-6611961 GAAAGTGGATGAGTGGCCGACGG + Intronic
987171126 5:15259287-15259309 GTAAGTGTATGAGGGGCCTGTGG - Intergenic
987727433 5:21720250-21720272 GAATCTGGATAAGTTGCCTTTGG + Intergenic
988576307 5:32428752-32428774 CACAGTGCATGAGTGGCCTGAGG + Intronic
988673801 5:33410238-33410260 GAATGTGGAAGACAGGCCTCTGG - Intergenic
992023803 5:72651386-72651408 GAATGTGCATGAGTCACCTCGGG - Intergenic
995904317 5:117105247-117105269 GAATGAGGATCTTTGGCCTGAGG + Intergenic
997400276 5:133596808-133596830 GAATGAGTGTGAGTGGCCTGCGG - Intronic
997420237 5:133760949-133760971 GGATGTGGATAAGTGACCTTTGG + Intergenic
997881035 5:137589881-137589903 GGATGAACATGAGTGGCCTGTGG + Intronic
998353508 5:141516082-141516104 GAAGGTGGCTCAGTAGCCTGGGG + Exonic
998396932 5:141824781-141824803 GAAGGTGGATCTGAGGCCTGAGG - Intergenic
998590453 5:143472255-143472277 GTATGTGGATGAGTGGAACGGGG + Intergenic
999389656 5:151180861-151180883 AATTGTGGATGTGGGGCCTGGGG - Intergenic
999527382 5:152422322-152422344 CAGTGTGGGTGAGTTGCCTGGGG + Intronic
1000427570 5:161110630-161110652 TTATATGGATGAGTAGCCTGAGG - Intergenic
1001395876 5:171419540-171419562 CAATGAGGATGCGGGGCCTGGGG - Intergenic
1002201147 5:177529110-177529132 GGATGTGGAGGAGTGGCAGGAGG + Intronic
1003334371 6:5156590-5156612 GAGTCTGGATGGGTGACCTGCGG + Intronic
1003955441 6:11161174-11161196 GATTTTGGATGAGTGGGATGAGG - Intergenic
1005501255 6:26430937-26430959 AAATGTGATTGAGTGGACTGTGG + Intergenic
1006457563 6:34140680-34140702 GGATGGGGAGGAGAGGCCTGGGG - Intronic
1006614982 6:35320008-35320030 GGATGTGGAGGTGAGGCCTGGGG + Exonic
1007232839 6:40360662-40360684 GAATCTGGAGGACTGTCCTGTGG - Intergenic
1013292237 6:108729439-108729461 GAATGGGGATGTGTAGCCTAGGG - Intergenic
1013551211 6:111209583-111209605 GAGTCTGGATAAGAGGCCTGTGG + Intronic
1015594041 6:134849413-134849435 GAAAGTGGAAGTGTGGGCTGGGG - Intergenic
1016628646 6:146201609-146201631 GAATTTGGAGGTGTGGCCTTTGG - Intronic
1018671418 6:166180800-166180822 GAATATGGAAGACTGTCCTGGGG - Intergenic
1018841639 6:167521704-167521726 GAATGTTGTTGAGTTGGCTGTGG - Intergenic
1019433722 7:1011317-1011339 GTATGTGGGTGTGTGGCATGTGG - Intronic
1019742806 7:2683157-2683179 CAATGTGGATGAGTTTCCTGCGG + Intronic
1022232353 7:28426435-28426457 GGATGTGGCTGAGGGGCCTAGGG - Intronic
1022517857 7:30987250-30987272 GCAGGTGGGTGTGTGGCCTGGGG + Intronic
1023709323 7:42975135-42975157 GAATGAGGAAAAGTGGCCAGGGG + Intergenic
1027440409 7:78213309-78213331 GAATGTGCATTAGTCACCTGGGG - Intronic
1030422080 7:109320021-109320043 GAATTTAGATGAGTTCCCTGAGG - Intergenic
1032797161 7:135287234-135287256 GCAGGTGGAGGGGTGGCCTGTGG - Intergenic
1033031209 7:137828928-137828950 GAATGTGGATGTGTAGCTTCAGG - Intronic
1034495931 7:151422174-151422196 CAATGTGGATGAGTGACCTCCGG + Intergenic
1034508995 7:151519445-151519467 GTCTGTGGGTGAGTGGCCGGTGG - Exonic
1034852665 7:154509921-154509943 GAATGGGGGTGAGGGGCATGGGG + Intronic
1035632935 8:1121792-1121814 GAATGAGGATGAGAGGCCACGGG - Intergenic
1035979357 8:4352112-4352134 GAATGAGGTGGACTGGCCTGTGG + Intronic
1036082797 8:5575738-5575760 GTATGTAGATGACTGGCTTGGGG + Intergenic
1041762572 8:61382851-61382873 GAAAGTGAATGATTTGCCTGAGG - Intronic
1041764930 8:61408945-61408967 CGATGCTGATGAGTGGCCTGAGG - Intronic
1042743158 8:72074700-72074722 GAAGATGGGTGAGTGACCTGAGG - Intronic
1042758952 8:72250872-72250894 GAAGTTGGATGAGTGGCCTAAGG - Intergenic
1044709017 8:95037519-95037541 GAATTTGGAAGAGAGGCCTATGG + Intronic
1049006017 8:139856193-139856215 GGATTTGGAGGAGAGGCCTGTGG + Intronic
1049321409 8:141998841-141998863 GCCCGTGCATGAGTGGCCTGTGG + Intergenic
1049576129 8:143390642-143390664 GACTGTGGGTGAGTGGCCGTGGG + Intergenic
1050526800 9:6553433-6553455 GAATGAGGATGCCTGTCCTGTGG - Exonic
1050627998 9:7526367-7526389 CAATGTGGAGGAGAGGCCTTTGG - Intergenic
1051463511 9:17351155-17351177 GAATGTGAATAGGTGGCCAGAGG - Intronic
1052337789 9:27337500-27337522 GAGTGTGGAAATGTGGCCTGAGG - Intronic
1053045927 9:34917330-34917352 GTGTGTGGAAGAGTTGCCTGAGG + Intergenic
1053117256 9:35516298-35516320 AAATATGGATGAGAGGCATGGGG - Intronic
1054784788 9:69200324-69200346 AACTGAGGATGAGAGGCCTGGGG - Intronic
1056914236 9:90730707-90730729 GAGTTTGGATAAGTGGGCTGGGG - Intergenic
1058642220 9:107098860-107098882 GGATGAGGATGGGTGGGCTGGGG - Intergenic
1058963361 9:110013126-110013148 GCAAGTGGATGAGAGTCCTGGGG - Intronic
1059614544 9:115934658-115934680 GAAAGTGGATGATTTGCCTGAGG - Intergenic
1186208403 X:7224458-7224480 GTATTTGGATGAGGGGCCTTTGG + Intronic
1187309516 X:18128365-18128387 CAATATGGATCAGTGGCCTTAGG + Intergenic
1189110362 X:38283433-38283455 GAATGAGAATGAGTGACCTAAGG - Intronic
1190096065 X:47482217-47482239 GAAAGTTGATGGGTAGCCTGTGG - Intronic
1190160934 X:48030898-48030920 GAAAGTGGACTGGTGGCCTGGGG - Intronic
1191174524 X:57484995-57485017 GAGGGTGGATAACTGGCCTGTGG + Intronic
1192192468 X:68999835-68999857 GAATGGGAATGAGTGTTCTGGGG - Intergenic
1192250647 X:69410683-69410705 GAATGTGGAAAAGTGGCAAGTGG + Intergenic
1192304692 X:69946373-69946395 GAATGTAGATACGTGGCCAGTGG - Intronic
1192337711 X:70235894-70235916 GAACTTGGATGAGGGGCCTGTGG - Intronic
1192471914 X:71406491-71406513 GAAGGTGGATGTTTGGCCTTTGG + Intronic
1193793087 X:85840777-85840799 GCATGTGGACAAGGGGCCTGGGG + Intergenic
1194958145 X:100205209-100205231 GAATGTGGATACGTGGTCTAGGG - Intergenic
1195970057 X:110463111-110463133 GAAGGTGTCTAAGTGGCCTGGGG + Intergenic
1197865152 X:131009600-131009622 GAAGGATGATGAGGGGCCTGAGG + Intergenic
1199492482 X:148416201-148416223 GCTTGTGGATGAGCAGCCTGAGG + Intergenic
1199600469 X:149538707-149538729 GAATGTGGACGACAGACCTGAGG + Intergenic
1199650119 X:149941234-149941256 GAATGTGGACGACAGACCTGAGG - Intergenic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic
1200837101 Y:7742782-7742804 GAATGTTGATGACTATCCTGTGG - Intergenic
1201134310 Y:10978936-10978958 GAATGGGGAGGAGTGGAGTGGGG - Intergenic
1201605155 Y:15775945-15775967 GAATGTGGAAGAGCATCCTGAGG - Intergenic