ID: 1114730984

View in Genome Browser
Species Human (GRCh38)
Location 14:24992334-24992356
Sequence TGCCTTTGCAGCATTGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114730984_1114730986 -4 Left 1114730984 14:24992334-24992356 CCATGACCAATGCTGCAAAGGCA 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1114730986 14:24992353-24992375 GGCACAGTCTACACTCCACATGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114730984 Original CRISPR TGCCTTTGCAGCATTGGTCA TGG (reversed) Intronic
900247154 1:1641859-1641881 TTCCTGGGCAGCAGTGGTCAAGG + Intronic
900258378 1:1708991-1709013 TTCCTGGGCAGCAGTGGTCAAGG + Intronic
904691932 1:32299674-32299696 TGATTTTGCAACATTGTTCAAGG + Intronic
905231142 1:36515563-36515585 TGCCTGAGGAGCATGGGTCAGGG - Intergenic
905369075 1:37473662-37473684 AGCCTTTGCAGAATTTCTCAAGG + Intergenic
905373543 1:37501750-37501772 TCCCTTCACAGCAATGGTCATGG + Intronic
905459235 1:38111506-38111528 TGCCTTTGCATCATTAGATATGG - Intergenic
908404742 1:63803737-63803759 AGCCTTTACAGGATTGTTCATGG + Intronic
909838854 1:80292388-80292410 TCCTTCTGCAGCATTGCTCATGG + Intergenic
916060211 1:161093204-161093226 TGACTTTGAAGCCTTGGTCCTGG - Intergenic
916407398 1:164510956-164510978 TGCATTTGAAGCTTTGGCCACGG - Intergenic
916659407 1:166907772-166907794 TGTATGTACAGCATTGGTCATGG - Intergenic
917678597 1:177343392-177343414 TGCCTTTGCAGCTGTGGCCCTGG + Intergenic
920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG + Intronic
922403195 1:225282419-225282441 TTCCTTTCCAGCATTGGACAGGG - Intronic
923627548 1:235626633-235626655 TGTCTTGGCAGCAATGGTCACGG - Intronic
1066929854 10:41744238-41744260 TGCCTTTGCAGAATCTGTGAAGG + Intergenic
1067995914 10:51273087-51273109 TGCCTCTGCATCACTGGGCATGG + Intronic
1069213172 10:65787126-65787148 TGCCTTTGCACCTATGGTGAAGG - Intergenic
1072538583 10:96381405-96381427 TGGCTTCCCAGCATGGGTCAGGG + Intronic
1074301989 10:112241427-112241449 TGTCTCTCCAGAATTGGTCACGG + Intergenic
1080223758 11:29936491-29936513 TGCCTTTCCAACATTTATCATGG + Intergenic
1080348118 11:31348580-31348602 TGCCGTTTCAGCATTGGTGGAGG - Intronic
1080354487 11:31426210-31426232 TGCCTTTTTAGCATTCTTCAAGG + Intronic
1083472395 11:62892702-62892724 TGCCTTTGGCTCATGGGTCAGGG + Intergenic
1087303949 11:96467481-96467503 TTCCTTTGCAGTTTTGTTCAAGG + Intronic
1102849138 12:116222472-116222494 TGGCATTACAGCATAGGTCATGG - Intronic
1104572641 12:129938511-129938533 TGGCTTTGCAGCTGTGGCCAGGG + Intergenic
1106407373 13:29485655-29485677 TGCCTTTGAGTCATTGGTGATGG - Intronic
1107527491 13:41247724-41247746 AGCCTTTGCTCCATAGGTCAGGG + Intronic
1112928040 13:104701572-104701594 TGTCTGAGCAGGATTGGTCATGG - Intergenic
1113217764 13:108062012-108062034 TGTCATTTCAGGATTGGTCATGG - Intergenic
1113532907 13:111042472-111042494 ACACTTTGCATCATTGGTCATGG + Intergenic
1114730984 14:24992334-24992356 TGCCTTTGCAGCATTGGTCATGG - Intronic
1114787041 14:25612443-25612465 TGCCTTTGCAGCAATGTGGATGG - Intergenic
1115137567 14:30129239-30129261 TGCCTGTGCAATATTAGTCAAGG + Intronic
1115427456 14:33277036-33277058 TTTCTTTGCAGCATTTATCATGG - Intronic
1115979675 14:39036393-39036415 CGCTTTTGCAGCAGTGGTGAGGG - Intronic
1116984231 14:51203166-51203188 TGCCTTCGCAGCAGTGCTCTGGG + Intergenic
1119147793 14:72332544-72332566 TGGGTTTCCAGCACTGGTCATGG - Intronic
1120110042 14:80543259-80543281 TGCTTTGGCAGCAGTCGTCAGGG - Intronic
1121999092 14:98631348-98631370 AACCTTTGAAGCATTGGTTATGG + Intergenic
1122120505 14:99550940-99550962 AGCCTTTGCTGGATTGGTGATGG - Intronic
1122368784 14:101215674-101215696 TGGCTTTCCAGCTTTGCTCAGGG - Intergenic
1128733328 15:70035198-70035220 TGCCCTAGGAGCACTGGTCATGG + Intergenic
1130192413 15:81749783-81749805 TGCCTTTGCAGGAAGGGTCTGGG - Intergenic
1130557704 15:84934468-84934490 TGCCTTTTCAACATTGTTTAAGG - Intronic
1130965920 15:88697560-88697582 TGGCTTTGCAGCTTTGGGCTTGG - Intergenic
1133862729 16:9611545-9611567 TGCCTTTGCAGCACTCTACAGGG - Intergenic
1135933026 16:26755491-26755513 TGTCTTTGCAGCATTGCTTTGGG - Intergenic
1136678212 16:31934845-31934867 AGCCTTTGCATCATTGCTCCAGG - Intergenic
1140881445 16:79201464-79201486 TAACTTTGCAGCATTCTTCAAGG + Intronic
1141001613 16:80313501-80313523 TGTGTTTGCAGCATGGTTCATGG - Intergenic
1141859787 16:86708680-86708702 TGCATTTGCAGCCTGTGTCACGG + Intergenic
1144432716 17:15209905-15209927 TGCCATTGGAGCCTTTGTCATGG + Intergenic
1148006591 17:44436117-44436139 TGCCTTTGTAGAATTGGGTACGG - Intronic
1152095012 17:78267745-78267767 CGATTTTGCAGCATTGGGCAGGG - Intergenic
1152323328 17:79621387-79621409 TGGCTTTGCAGGGTTGCTCAGGG - Intergenic
1158823158 18:61184490-61184512 AGCCTTTTCAGCATTGTGCAAGG + Intergenic
1165588082 19:36939255-36939277 TGCCTTTGTACCATTTGTCAGGG + Intronic
1167816666 19:51888203-51888225 TGGCTTTGCAACATTAGCCAGGG + Intronic
1168012040 19:53540814-53540836 TGTCTTTGCAGCTTTGATGATGG - Intronic
926197181 2:10771150-10771172 TGCCTTTAAAGCTTTGGCCATGG + Intronic
926347128 2:11957635-11957657 CTCCTTTGCAGCACAGGTCAGGG - Intergenic
928060515 2:28107959-28107981 TGCCTATGCAGCATGGGCAATGG - Intronic
928183397 2:29087131-29087153 TGGCTGTGCAGCATTTGTCCCGG + Intergenic
929123114 2:38499695-38499717 TGCCTTTGCAGAAATGCACAAGG + Intergenic
930166398 2:48207692-48207714 TGCCTTTGCAGAGTTGATGAAGG + Intergenic
930600409 2:53436310-53436332 TGTGTTTTCAGCACTGGTCAAGG + Intergenic
931565323 2:63609973-63609995 TGCCTTTGAAGCATGGGTTTCGG + Intronic
932896087 2:75641473-75641495 TGACTTTGGAGAATTTGTCATGG - Intergenic
933061099 2:77737579-77737601 TTCCTTGGCAACATTTGTCAGGG - Intergenic
935684610 2:105672292-105672314 AGACTCTGCAGGATTGGTCAGGG + Intergenic
939052201 2:137320915-137320937 TGCATTTGCTGCATTGCTCTGGG - Intronic
942914343 2:181285055-181285077 TGGCTTTGTAGAATTGGTTATGG + Intergenic
942996196 2:182263527-182263549 TGCATTTCCAGCATTTGACATGG - Intronic
944173150 2:196801040-196801062 TGCCTTTGGAACCTTGGGCAAGG + Intergenic
944595542 2:201257563-201257585 TGTCTTTGTAGCATTGATCCTGG - Intronic
947368956 2:229425417-229425439 TGCCTTTGCTGAACTGGTCAAGG - Intronic
1171102598 20:22399603-22399625 TCCCTTTGCAGCATTGTTGTAGG - Intergenic
1173477748 20:43373985-43374007 TGGCTGTGCAACCTTGGTCAAGG - Intergenic
1174777956 20:53363043-53363065 TCACTGTGCACCATTGGTCAAGG - Intronic
1174924353 20:54741135-54741157 TGGCTTTGCAGCAATGATGAAGG - Intergenic
1175268030 20:57714309-57714331 TGCCTCTGCAGAATTAGTCTTGG + Intergenic
1177320738 21:19516548-19516570 TTCCTTTGCAGCAATGTTAATGG + Intergenic
1181443542 22:22951260-22951282 TGCTTTGGCTGCATGGGTCAGGG - Intergenic
1182239589 22:28904686-28904708 TTCCTTTGCAGCTTTGGCGAAGG + Intronic
1182634623 22:31715327-31715349 TTCCTTGGCAGCAGTGATCACGG + Exonic
1182888778 22:33798769-33798791 TGCATTTGCAGCCTGTGTCATGG - Intronic
1185288056 22:50011093-50011115 TGCCTGGGCAGCCTTGGACAGGG - Intronic
953553331 3:43922460-43922482 TTCCTTTGCAGCACTTATCATGG - Intergenic
953681282 3:45040160-45040182 TGCTTATGCAGCAAAGGTCATGG - Intergenic
956425835 3:69133816-69133838 TGCATTCGTAGCATTGTTCATGG + Intergenic
956981202 3:74640761-74640783 TGGCTTTGCAGCACTGAACAGGG - Intergenic
956985632 3:74696610-74696632 TGGCTTTGCAGCATTGAAAAAGG + Intergenic
959491072 3:106989211-106989233 TGCCATAGCAGCTTAGGTCATGG - Intergenic
960090098 3:113630300-113630322 TGCTTCTCCAGCATTTGTCAGGG - Intergenic
961154315 3:124666017-124666039 TTCCTTTGCAGTATGGGCCAAGG - Intronic
961502415 3:127346196-127346218 TGCCTCTGCAGCAGAGGTGAAGG + Intergenic
961938842 3:130615888-130615910 TGCTTTGGCAAGATTGGTCATGG + Intronic
963315412 3:143753504-143753526 TGCTTGTGCAGCATTAGGCAAGG - Intronic
966420990 3:179733846-179733868 TGGCTTTGCAACTTTGGGCAAGG - Intronic
970673547 4:18422655-18422677 TGCCTTTGCAGCAGTGGACGAGG + Intergenic
971298194 4:25419286-25419308 TGCCTTTTCAGACTTGGTTAAGG + Intergenic
974988991 4:69061895-69061917 TACCTTTTCAGGATGGGTCATGG + Intronic
976792729 4:88897265-88897287 AGTCTATGCAGTATTGGTCATGG + Intronic
978921447 4:114188015-114188037 GGCCTTTGCAGAATTAGGCATGG - Intergenic
980543484 4:134226544-134226566 TGTCTTTACAGAATTGCTCAGGG - Intergenic
984932577 4:184860099-184860121 TCCCTTTGCAGCCATGATCAAGG + Intergenic
986064609 5:4223320-4223342 TGCCTTTGCAGCAGCGGTGAGGG - Intergenic
987308463 5:16660484-16660506 TGGCTTAGCAGCATTTGTCTTGG - Intergenic
987688483 5:21235746-21235768 TGTCTTTGCAGCATTCTCCAAGG + Intergenic
990866544 5:60386599-60386621 AGCCAGTGCAGCATTGGGCAGGG + Intronic
992291542 5:75284426-75284448 TGTCTCTCCAGGATTGGTCATGG - Intergenic
992414643 5:76540566-76540588 TGACTTTGCAGCATTAATCTGGG + Intronic
992836991 5:80651418-80651440 TTACTTTGCAGCCTTCGTCAGGG + Intronic
993751106 5:91669267-91669289 TGCCTCTGAAGCATTAATCAAGG - Intergenic
995619349 5:114006790-114006812 TGCCATTGCACCAGTAGTCAAGG + Intergenic
999716489 5:154365020-154365042 TCCCTTTTCAGCAGTGGGCAGGG - Intronic
1002879825 6:1241588-1241610 TGCATTTGAAGCATTTATCACGG + Intergenic
1008666003 6:53717106-53717128 TCTCTTTGCAGCACTGGACATGG - Intergenic
1011754341 6:90483623-90483645 AGCCTCTGCACCATTGGCCACGG + Intergenic
1011837243 6:91448064-91448086 TCCCTTTGCAGCATGGGACATGG + Intergenic
1012305873 6:97656444-97656466 AGTCTTTGGAGCATTGTTCAGGG + Intergenic
1014159175 6:118147407-118147429 AGCCTATGCAGAGTTGGTCATGG + Intronic
1016353913 6:143196878-143196900 TGAATTTGCAGCAGTCGTCATGG + Intronic
1017488393 6:154923266-154923288 TCCCTTTGATGCACTGGTCAGGG + Intronic
1018429366 6:163711566-163711588 TTCCTTTCCAGAATTGGTTATGG - Intergenic
1019211190 6:170406430-170406452 TGCCTTTGGCCCGTTGGTCAAGG - Exonic
1022340957 7:29467995-29468017 TGTCTTTGCAGCATGGGTCTTGG + Intronic
1024772574 7:52742097-52742119 TGTCTTTGCAGCATGGGTTTTGG - Intergenic
1028872133 7:95781647-95781669 TGCCTTTCCAGCATTTGGGAAGG - Intronic
1032709029 7:134446603-134446625 TGCCCTTGCAGCATTGGTGGCGG - Intronic
1033359480 7:140628273-140628295 TCCCTTTGCAGCAGAAGTCAGGG + Intronic
1039924340 8:41915697-41915719 GGCCTTTGAAGCAGTGGTGAGGG - Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1044828812 8:96224937-96224959 TGCCTTTTCAACTTTGTTCATGG - Intergenic
1044863896 8:96550673-96550695 TGCCTATACAGCAGAGGTCAGGG - Intronic
1046187391 8:110739654-110739676 TTCCGTAGCAGCATGGGTCACGG + Intergenic
1048586582 8:135779659-135779681 TGACTATGAAGCATTGTTCAAGG + Intergenic
1049418686 8:142507264-142507286 GGCCTTGGCAGCATGTGTCAGGG - Intronic
1053076855 9:35140910-35140932 CTGCTTTGCAGCATTGGTCAGGG - Intergenic
1055758626 9:79582434-79582456 TGCTGTTGCAGCACTGGTGAAGG + Intronic
1059904696 9:118969715-118969737 TGCCTATTCTGCATTGATCATGG + Intergenic
1060690980 9:125659964-125659986 TGTCTTGGCAGCATTTGACACGG + Intronic
1187014910 X:15316910-15316932 TGCATTTCAAGCATTGGTAAAGG + Intergenic
1188390673 X:29615518-29615540 AGCCTTTGCTGCAGTGGTCTGGG - Intronic
1189313234 X:40034720-40034742 TGCCATTGCAGCAATGGGCTGGG + Intergenic
1194927537 X:99843679-99843701 TGCTTTTGCTGCATCTGTCAAGG - Intergenic
1195703089 X:107719547-107719569 TACCTTTGCCGCCTTGGGCAAGG - Intronic
1197013091 X:121591014-121591036 TGACTATGTGGCATTGGTCACGG - Intergenic
1197998154 X:132402871-132402893 TGCCTTTGCAGAATTGAATATGG - Intronic
1199853928 X:151744514-151744536 TGCCTCTCCAGCATTGGCCTTGG + Exonic
1199995959 X:153026958-153026980 TGCCTGTGCAGCAGTGCTCAAGG + Intergenic