ID: 1114731390

View in Genome Browser
Species Human (GRCh38)
Location 14:24996378-24996400
Sequence CAGGTATAGGAAGCCCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114731390 Original CRISPR CAGGTATAGGAAGCCCAGTT AGG (reversed) Intronic
902620745 1:17649412-17649434 CAGGGATAGGAGCACCAGTTGGG + Intronic
906264805 1:44420452-44420474 CAGGTATATGATTCCCATTTAGG + Intronic
906445044 1:45889063-45889085 CAGATAAAGAAAGGCCAGTTAGG - Intronic
909033491 1:70569609-70569631 CTGATATAAGAAGACCAGTTAGG + Intergenic
909468324 1:75999679-75999701 CAGAAATAGGAAGGCCAGTTAGG - Intergenic
910552068 1:88486444-88486466 CAGGTGTAGGAGCCCCATTTGGG + Intergenic
910857387 1:91709113-91709135 CGTGTATATGAAGCCCAGCTTGG - Intronic
912213889 1:107585317-107585339 TAGGCACAGGAAGACCAGTTAGG - Intronic
912546796 1:110456919-110456941 CAGGTGTAGGGAGCCCAGGGAGG + Exonic
915786830 1:158622894-158622916 CAGATATTGGAAACTCAGTTTGG - Intronic
916679073 1:167088227-167088249 CAGGTAAGGGAGACCCAGTTAGG - Intronic
919849350 1:201662152-201662174 CAGGCATCGTAAGCCCTGTTGGG + Intronic
922337855 1:224632288-224632310 CAGGTATAGGCAGACCAGGGTGG + Intronic
923787891 1:237085722-237085744 CAGGGATAGGAAGATCAGTGAGG + Intronic
1070816628 10:79328533-79328555 CAGGAACAGGAACCCCAGGTGGG + Intergenic
1071270117 10:83999356-83999378 CTCGTGTAGGAAGCCCAGTTGGG - Intergenic
1071294183 10:84207273-84207295 CAGGTAAAGGAAACCCAGGAGGG + Intronic
1075464327 10:122640214-122640236 CAGGTCGAGGAAGTCCAGTATGG + Exonic
1075703411 10:124483882-124483904 CAGGTGTATGAAGTCCAGTGAGG + Intronic
1080127110 11:28748519-28748541 CAGTTTTAGGATGCCCAGTTTGG + Intergenic
1082223772 11:49676149-49676171 CACCTATATGAAGCCCTGTTAGG + Intergenic
1082259202 11:50064554-50064576 GAGGTATGGGAAGTCCATTTAGG + Intergenic
1085511596 11:77090961-77090983 CAGGTCTAGGAAACCCAGTGAGG - Intronic
1086625282 11:88943113-88943135 CACCTATATGAAGCCCTGTTAGG - Intronic
1088019880 11:105106832-105106854 CAAGCATTGGAAGCCCAGTCAGG + Intergenic
1088630248 11:111767149-111767171 GAGGTCTAGGGAGGCCAGTTTGG - Intergenic
1092856805 12:12681515-12681537 GATGTGTAGGAAGCCCAGCTAGG + Intronic
1096088169 12:48880294-48880316 CAGATAAAGGAAGCTCACTTTGG - Intergenic
1105764362 13:23544816-23544838 CAGAAACAGGAAGACCAGTTAGG - Intergenic
1106761921 13:32876006-32876028 CATGTATAGGAAGCATATTTGGG - Intergenic
1108057592 13:46499842-46499864 AAGGTGGAGGAAGACCAGTTAGG + Intergenic
1110706577 13:78605949-78605971 CATGGATAGGAAGCCCATCTAGG + Intergenic
1114731390 14:24996378-24996400 CAGGTATAGGAAGCCCAGTTAGG - Intronic
1114914415 14:27244833-27244855 CAGGAAGAGGTAGACCAGTTAGG - Intergenic
1119173214 14:72550222-72550244 CAGCTAAAGAAAGCCCAGTCAGG + Intronic
1119534898 14:75395082-75395104 GAGGAATTGGAAGCCCAGTGAGG + Intergenic
1121553963 14:94822455-94822477 CGGGTACAGGAAGCCCTGTGAGG - Intergenic
1132809801 16:1792103-1792125 CAGGTTGAGGAAGCCCAGGCTGG + Exonic
1135003304 16:18796047-18796069 CAGATGTATGAAGCCCAGTTGGG - Intronic
1139222233 16:65195412-65195434 CATCTATAGGGAGTCCAGTTGGG - Intergenic
1139652794 16:68371096-68371118 CAGGCACAGGAAGTCCAGGTTGG + Exonic
1140200320 16:72889695-72889717 CAGGCATGGGAGGCCCAGGTTGG - Intronic
1140862591 16:79031224-79031246 CAGGGATGGGAAACCCAGATGGG - Intronic
1142155543 16:88531360-88531382 CAGTTATAAGCAGCCCATTTGGG + Intronic
1143416781 17:6756387-6756409 CAAGTATGAGTAGCCCAGTTGGG - Intronic
1145942057 17:28747752-28747774 AAGGTAGAGCCAGCCCAGTTGGG + Intronic
1148494237 17:48043094-48043116 CAGCTCGAGGAAGCCAAGTTGGG + Intergenic
1149119908 17:53150415-53150437 CAAGTCTAAGAAGCCCAGATTGG - Intergenic
1150131351 17:62670877-62670899 CAGGTCTGGGAAGCCCAGGAGGG - Intronic
1153859186 18:9182889-9182911 TAGGGATAGCAAGACCAGTTAGG - Intronic
1164779178 19:30878956-30878978 CACGTGTAGGAAGCCCAATATGG + Intergenic
928499786 2:31878447-31878469 TAGGTCTAAGAAGACCAGTTAGG + Intronic
935830520 2:106996914-106996936 CAGGTCTCAGAAGCCCAGATTGG - Intergenic
938983180 2:136546191-136546213 CAGCCATGGGAAGCCCAGTGAGG - Intergenic
940161984 2:150723471-150723493 ATGGTAAAGGCAGCCCAGTTTGG + Intergenic
940940115 2:159550275-159550297 CAGGGATAGGCAGGCCAGTAGGG + Intronic
946255965 2:218442052-218442074 CAGCCATAGGAACACCAGTTAGG + Intronic
947065312 2:226217878-226217900 GGGGTATAGGAAACCCAGATAGG - Intergenic
1169146493 20:3255884-3255906 CAGGGAGAGGAAGCCCAGTGGGG + Intronic
1171988018 20:31674392-31674414 CTGGTGTAGGCATCCCAGTTAGG - Intronic
1173489595 20:43468981-43469003 CACCTATAGGAAGCCAAGGTGGG + Intergenic
1174851833 20:54003043-54003065 CAGGTTGAGGAACCCCAGCTGGG + Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1178995469 21:37395239-37395261 TAGGTATAGTTAGCCTAGTTAGG - Intronic
1184599204 22:45532694-45532716 CAGGTACATGAGGCCTAGTTGGG + Intronic
949355172 3:3172896-3172918 CAGGAAAGGGAAGCACAGTTTGG - Exonic
949499846 3:4669287-4669309 CGTGTGTTGGAAGCCCAGTTAGG - Intronic
950431209 3:12952264-12952286 CTGGTGTAGGAAGCTCAGTTTGG - Intronic
951704751 3:25532728-25532750 CAGTTATAGGAAGCCTCTTTAGG - Intronic
952911540 3:38192812-38192834 CAGTGATAGGAAGGCCAGTGTGG - Intronic
955987852 3:64593643-64593665 CAGAGATAGGAAGCCCGTTTGGG - Intronic
958180797 3:90057966-90057988 CAGGTCTAGGGCACCCAGTTAGG - Intergenic
961552672 3:127678006-127678028 CAGGTAGAGGAAGCCTTGTTGGG + Intronic
963271048 3:143286182-143286204 CAGAAAAAGGAAGCCCAATTAGG - Intronic
963563162 3:146892854-146892876 CATATTTAGGAAGCCCATTTTGG - Intergenic
963880513 3:150523483-150523505 CCTGCATAGGAAGCCAAGTTGGG + Intergenic
966119190 3:176503566-176503588 TAGGTATAGGAAGCACTGTAAGG + Intergenic
972120095 4:35690551-35690573 CATGTGTTGGAATCCCAGTTTGG - Intergenic
972295745 4:37736129-37736151 CATGTAAAAGAAGCCCAGTGGGG + Intergenic
974834293 4:67228633-67228655 CAGATATAGGCAGCCTAGTACGG + Intergenic
975938743 4:79614493-79614515 TAGGTATAGGAAGACAAGTTAGG - Intergenic
977087540 4:92621547-92621569 CAGCTATAGGAAGCTGAGGTGGG + Intronic
977644193 4:99393439-99393461 CAGGAATAGGAATCACAGTGTGG + Intergenic
984984175 4:185311479-185311501 CAGGTCTTGGAAGACAAGTTTGG - Intronic
985347402 4:189020643-189020665 CAGGCATGAGAAGCCCAGTCAGG + Intergenic
985488954 5:167925-167947 CTGATTTGGGAAGCCCAGTTTGG + Intronic
985973434 5:3394910-3394932 CAGGTATTAGAAGCCCAGGCAGG - Intergenic
988451160 5:31344412-31344434 CAGATATAAGAAGACCAGTTGGG - Intergenic
995760564 5:115557301-115557323 CAGTTGTAGGAAGGCCTGTTAGG - Intergenic
996893566 5:128453459-128453481 CAGTTATAGGAAGGCCAGAGTGG - Intronic
998979231 5:147682451-147682473 CAGGTATACAAAGAACAGTTAGG + Intronic
1000021951 5:157325831-157325853 AAGGCATAGGAAGGGCAGTTGGG - Intronic
1003494467 6:6652244-6652266 CCGGTGTAGGGAGCCCATTTTGG - Intronic
1005368081 6:25099571-25099593 AAGGGAAAGGAAGACCAGTTTGG - Intergenic
1006478508 6:34273384-34273406 CAGGCAGAGGAAGCCAAGTTTGG - Intergenic
1009373722 6:62940778-62940800 CAGGTAAATAAAGCCCACTTAGG - Intergenic
1009440187 6:63668586-63668608 CAGGTTTAGGAAGCCGATGTGGG - Intronic
1011389401 6:86835642-86835664 TGGGTTTAGGAAGACCAGTTAGG - Intergenic
1012868212 6:104643007-104643029 GGGGAATAGGAAGCCCATTTTGG + Intergenic
1015054026 6:128877697-128877719 CATGAATGGGAAGCCAAGTTGGG + Intergenic
1016658012 6:146543560-146543582 CCGGGAGAGGAAGTCCAGTTGGG + Intergenic
1016799230 6:148152198-148152220 TGTGTATAGGAAGCCCAGTTTGG + Intergenic
1021537646 7:21723499-21723521 CAGAAATAGAAAGCCCAGTGAGG - Intronic
1022888009 7:34666381-34666403 CAGTTAAAGGTAGCACAGTTTGG + Intronic
1023778856 7:43636997-43637019 CAGAAATCAGAAGCCCAGTTTGG - Intronic
1023834643 7:44061007-44061029 CAGGAATAGGACCCCCAGTGAGG + Exonic
1025826342 7:65013898-65013920 GAGGTATGGGAAGTCCATTTCGG - Intergenic
1025913900 7:65850363-65850385 GAGGTATGGGAAGTCCATTTCGG - Intergenic
1025975664 7:66367685-66367707 GAGGTATGGGAAGTCCATTTCGG + Intronic
1028906250 7:96157325-96157347 CAGTGATAGGAACCACAGTTTGG - Intronic
1030966971 7:116005247-116005269 CAGGTATAGGTGGAACAGTTTGG + Intronic
1033640245 7:143256472-143256494 CTGGTATTGGAACCCCAGTTTGG - Intronic
1035556174 8:568972-568994 CAGGAATAAGAGGCCCAGGTGGG + Intergenic
1035863813 8:3059681-3059703 CAGACGTAGGAAGCCCAGTAGGG + Intronic
1036170041 8:6475197-6475219 CTGGTACTGGAAGCCCAGTGTGG - Intronic
1037555089 8:20014387-20014409 CAGAGGAAGGAAGCCCAGTTAGG - Intergenic
1038321197 8:26528850-26528872 CAGGTTTAGGGAGGCCAGTTTGG + Intronic
1039144034 8:34425115-34425137 TAAATATAGGATGCCCAGTTAGG + Intergenic
1043126277 8:76399480-76399502 CAGGTATAGGAAGGCAATTCAGG - Intergenic
1045049023 8:98306172-98306194 CAGGTTTAGGAAGCCGTGTTTGG - Intergenic
1049012642 8:139897629-139897651 CAGGTTTAGGAAGCCTCCTTGGG + Intronic
1050009630 9:1172510-1172532 CAAGTGTGGGAAGCCAAGTTTGG + Intergenic
1056454567 9:86747304-86747326 CAGGTATGGGAAGCTATGTTGGG - Intergenic
1056823261 9:89859475-89859497 CTGGTCTAGGCACCCCAGTTTGG + Intergenic
1057545696 9:96019443-96019465 CAGGTGAAGGAAGGCCACTTAGG - Intergenic
1057555078 9:96081603-96081625 CTTGCATAGGAAGCCAAGTTGGG - Intergenic
1061039695 9:128132808-128132830 CTGGTCTAGGCACCCCAGTTTGG - Intergenic
1203760653 EBV:11954-11976 AAGGCATCTGAAGCCCAGTTTGG - Intergenic
1190872198 X:54433707-54433729 CAGGTATTGGAAGCCCAGTCTGG + Intergenic
1192736265 X:73852120-73852142 CAGGTATCCGAAGCCCCGATGGG + Intergenic
1195573025 X:106417628-106417650 CAGAAGTAGGAAGACCAGTTAGG + Intergenic
1195738719 X:108040229-108040251 CAGGGAAAGGAATACCAGTTAGG + Intergenic