ID: 1114732436

View in Genome Browser
Species Human (GRCh38)
Location 14:25007673-25007695
Sequence GCTCAGTAAACATTAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 1, 2: 5, 3: 62, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114732431_1114732436 21 Left 1114732431 14:25007629-25007651 CCATGTTGTCTGGTATCCAAATC 0: 1
1: 0
2: 1
3: 12
4: 201
Right 1114732436 14:25007673-25007695 GCTCAGTAAACATTAGTGGAAGG 0: 1
1: 1
2: 5
3: 62
4: 273
1114732434_1114732436 5 Left 1114732434 14:25007645-25007667 CCAAATCAGTGCAGGGCACATTA 0: 1
1: 0
2: 3
3: 8
4: 103
Right 1114732436 14:25007673-25007695 GCTCAGTAAACATTAGTGGAAGG 0: 1
1: 1
2: 5
3: 62
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114732436 Original CRISPR GCTCAGTAAACATTAGTGGA AGG Intronic
902055848 1:13599803-13599825 GCTTGGTAAATATTTGTGGAAGG + Intronic
902647493 1:17810938-17810960 CCTCTGTAAACATTGGTGTAAGG + Intronic
902677422 1:18018433-18018455 GCTCAGTAAATATTGATGGGTGG - Intergenic
903052732 1:20613600-20613622 GCTCAGTAAACGTTTATGGATGG + Intronic
904892941 1:33793041-33793063 GCTTAGTAAATATTTGTGGAAGG - Intronic
905552673 1:38856451-38856473 GCTCAACAAACATTTATGGAGGG - Intronic
906158166 1:43626442-43626464 GCTCATTAAATATTTGTTGAAGG - Intergenic
906716054 1:47970072-47970094 GCTCAGCAAACATTGGTGAATGG + Intronic
907116951 1:51977326-51977348 GCTCAGTAAATATTTGCTGAAGG - Intronic
907400640 1:54222935-54222957 GCTCAGCAAACACGAGTGGATGG + Intronic
907460154 1:54600984-54601006 GCTCTGTAAACAATGGTGGAGGG + Intronic
907552231 1:55314196-55314218 GCTCAGTAAGTATTTGTTGAAGG + Intergenic
907734014 1:57094222-57094244 ACTCAGTAAATATTATTGAAGGG - Intronic
907751879 1:57270776-57270798 GCTCAGTGAGTATTGGTGGAGGG - Intronic
908061122 1:60350700-60350722 ACTCAATGAACATTTGTGGAAGG - Intergenic
908554672 1:65245841-65245863 GTTCAGTGTACATTAGTTGAAGG + Intergenic
909960260 1:81831831-81831853 GCTCAGTAAATATTTGTTGAAGG + Intronic
910199510 1:84684501-84684523 GCTTATTAAACCTTAGAGGATGG + Intronic
910861514 1:91746918-91746940 GCTCAGAAATCAGTAGTGTAGGG + Intronic
912211590 1:107562978-107563000 GCTCAATACACATTTGTAGAAGG + Intergenic
912501827 1:110127685-110127707 ACTCAGTAAATATTATTTGAGGG + Intergenic
914724375 1:150315170-150315192 GCTCAGTAAATATTTATTGAAGG + Intergenic
917839405 1:178965238-178965260 GCTTAACAAACATTTGTGGAGGG - Intergenic
918859496 1:189804116-189804138 GCTCTTTAAAAATTAGTGAATGG + Intergenic
918881558 1:190130543-190130565 GCTCAGCAAACATTAGGATAAGG - Intronic
920112852 1:203599242-203599264 GCTCAGTAAACATTTGTGGGTGG - Intergenic
920655655 1:207872694-207872716 GCTCAATAAACATTTGCTGATGG - Intergenic
921095717 1:211885584-211885606 GTTCATTAGACATTAGTAGAGGG - Intergenic
921706721 1:218330157-218330179 TCTCAATAAATATTTGTGGAAGG + Intronic
924650579 1:245923373-245923395 GCCCAGTAAATATTTGTGTAAGG - Intronic
1064303898 10:14148084-14148106 GCACAATACACATTAATGGAGGG - Intronic
1064912876 10:20422185-20422207 GACCACTAATCATTAGTGGAAGG - Intergenic
1065853839 10:29813952-29813974 GCTCTGTAAACATGGGTGGCAGG + Intergenic
1067540832 10:47151296-47151318 GCTCAATAAATATTAGCTGAAGG - Intergenic
1067924212 10:50491395-50491417 GCTGAGTATCTATTAGTGGAAGG - Intronic
1068657477 10:59590540-59590562 GCTCAAGAAACATTTGTTGATGG - Intergenic
1069050010 10:63782356-63782378 AGTCAGTAAATATTTGTGGATGG + Intergenic
1069840119 10:71334599-71334621 GCTCAGTAAATATTTGCAGAAGG + Intronic
1070272000 10:74965470-74965492 GCTCATTAAATATTAGTTGAAGG + Intronic
1070369261 10:75766377-75766399 GCTCAAAAAGCATTAGTTGAAGG + Intronic
1071152696 10:82653360-82653382 TCTTTGTAAACTTTAGTGGAGGG + Intronic
1071153262 10:82661059-82661081 GCTCAGTAAATATTTGTCAAAGG - Intronic
1071161983 10:82757771-82757793 GCTCAATAAATATTTGTTGAAGG + Intronic
1071968177 10:90874063-90874085 GCTCAGTAAATATTTGAGGGAGG + Intronic
1074193435 10:111158034-111158056 GCTCAGTAAATGTCTGTGGAAGG - Intergenic
1074719371 10:116251250-116251272 GCTCAGTAGACATTTGTTGATGG + Intronic
1074773330 10:116747661-116747683 ACTCAGTAAATGTTTGTGGATGG + Intergenic
1075341679 10:121651251-121651273 GCTCAATAAGTATTTGTGGAAGG + Intergenic
1076465170 10:130675531-130675553 GCAAAGTAAACAGTAGTAGATGG - Intergenic
1078254326 11:9644587-9644609 GCTCAATACATATTTGTGGAAGG - Intergenic
1078474287 11:11618395-11618417 GTTCAGTAAACATTAGTTAAAGG + Intronic
1078754528 11:14196514-14196536 GCTCAGTAAACATTTGTAGAAGG + Intronic
1080038567 11:27735025-27735047 ACTCAGTAAACATTTGGTGATGG - Intergenic
1080251242 11:30236258-30236280 CCTCAATAAATATTAGTTGATGG + Intergenic
1081331148 11:41801850-41801872 AATCAGTAAATATTTGTGGAAGG - Intergenic
1083078851 11:60070084-60070106 GCACAGTAAACATCAATGAATGG + Intronic
1083844425 11:65322523-65322545 GCTCAGTAAACAGCCGTGGATGG - Intergenic
1085216667 11:74838865-74838887 TCTTAGTAAATATTATTGGAAGG + Exonic
1085835948 11:79956551-79956573 GTACAGAAAACAGTAGTGGAGGG + Intergenic
1087557176 11:99735646-99735668 CCTCAGTAAAGATGAGAGGAAGG - Intronic
1087574555 11:99974300-99974322 GCTCAGTTAACATCAGTTAAGGG + Intronic
1089117564 11:116108619-116108641 GCTTAGTAAACATTTGCTGAAGG + Intergenic
1089349538 11:117814568-117814590 ACTCAGTAAACATGTATGGAGGG + Intronic
1089579507 11:119472720-119472742 CATCAGTAAACAGAAGTGGATGG - Intergenic
1089744317 11:120606405-120606427 GCGCTGTAAACATTTGTGGAAGG + Intronic
1090044605 11:123320141-123320163 GCTCAGTAAGCATGTGTGGAAGG - Intergenic
1090599917 11:128359284-128359306 GCTCAGTAAATATCTGTTGAAGG - Intergenic
1090632784 11:128664793-128664815 GGTAGGTAAACATGAGTGGAAGG - Intergenic
1090716265 11:129433962-129433984 GCTCAGTAAATATTCATGGCTGG + Intronic
1090885909 11:130876582-130876604 GCTAAGTACACATGAGGGGAAGG + Exonic
1091207624 11:133832573-133832595 GCTCAGGAAATATTCGTGGAAGG - Intergenic
1092746232 12:11674952-11674974 CCTCAGTCAACATTTATGGAAGG + Intronic
1093196059 12:16130731-16130753 GCACAGTAAACATTCCTGAATGG - Intergenic
1094009474 12:25792125-25792147 GCTTAGTAAATATTTGTCGAAGG - Intergenic
1094036738 12:26079997-26080019 CCTCAGTGACCATTAATGGATGG + Intergenic
1096119585 12:49079243-49079265 GCTTAATAAATATTTGTGGAAGG + Intergenic
1096763684 12:53865164-53865186 GCTCAGCCAGCATTTGTGGAAGG - Intergenic
1096863630 12:54548457-54548479 GGTTAATAAACATTTGTGGAAGG - Intergenic
1097399302 12:59109771-59109793 GCTCATTAAAAATTTGTGAATGG - Intergenic
1099098784 12:78410433-78410455 ATTCAGTAAACATTTGTGGAAGG - Intergenic
1099728222 12:86462295-86462317 GCTCAGTAAATATTTGTTAAAGG - Intronic
1100493154 12:95100270-95100292 GCCCAGTAAACATTTGTTAATGG + Intronic
1101701168 12:107175581-107175603 GCTCAATAAATATTTGTTGAAGG - Intergenic
1101827715 12:108233377-108233399 GCTCAGTAAACATCTGTGAATGG - Intronic
1102231014 12:111262265-111262287 GCTCAGGAAACATTTGTTGAGGG + Intronic
1102477218 12:113196458-113196480 GCTGGGAAAACATCAGTGGAAGG - Intronic
1104266943 12:127242655-127242677 GGTCAGTAAATATTTTTGGAAGG - Intergenic
1104530016 12:129560971-129560993 GCCCAGTAGATATTAGTGAATGG + Intronic
1108139899 13:47409372-47409394 GCTCAGAAAACATTTGTTGGAGG - Intergenic
1111761934 13:92477205-92477227 TCTGAGTAAACAAAAGTGGAGGG + Intronic
1111764925 13:92516477-92516499 TATCAGTAAATATTATTGGAAGG + Intronic
1112641590 13:101281396-101281418 ACTCAGTAAATATCAGTTGATGG + Intronic
1112735425 13:102410730-102410752 GCTCAGTAAGCACTTATGGAAGG - Intergenic
1114732436 14:25007673-25007695 GCTCAGTAAACATTAGTGGAAGG + Intronic
1116562460 14:46398165-46398187 TCTCATTAAAAATTAGTAGAGGG - Intergenic
1116584385 14:46684168-46684190 GCTCACTAATCATTAGAGAAAGG - Intergenic
1116711818 14:48377659-48377681 GGTCAGTAAACATTAATCAAGGG + Intergenic
1117565139 14:56986776-56986798 AGTCAGCAAACATTCGTGGAGGG + Intergenic
1117710006 14:58518588-58518610 ACTCAGTAAACATTAATTGAGGG + Intronic
1118771312 14:68944435-68944457 GCTCAGTAAGAATTTATGGAAGG - Intronic
1119381829 14:74234093-74234115 GCTCAATAAATATTTGTTGAAGG + Intergenic
1119416491 14:74473741-74473763 GCTCAGTAAGTATTGGTTGAAGG + Intergenic
1119989802 14:79183500-79183522 GCTCAGTAAACATGAGTAGTGGG + Intronic
1120069508 14:80087139-80087161 TCTCAGCAAAGATTAATGGATGG + Intergenic
1120197340 14:81499437-81499459 GGTAAGTAGACTTTAGTGGAAGG - Exonic
1121400788 14:93675163-93675185 GGTCAGTAAATATTTGTGGTGGG - Intronic
1121610431 14:95275008-95275030 GGTCAGTAAATATTTGTTGAAGG - Intronic
1124143084 15:27094565-27094587 GCTCAGGAAACATAAATAGAGGG + Intronic
1125305370 15:38306357-38306379 GCTCAGAAAACAATAATGGCAGG + Intronic
1127282541 15:57504286-57504308 GCTCAGTAAAAGGTAGTTGACGG + Intronic
1127332262 15:57950793-57950815 GCAGAATAAACATTTGTGGAGGG + Intergenic
1128380259 15:67107126-67107148 ACTCAGTAAACATTTATTGAGGG - Intronic
1128485912 15:68088651-68088673 GCTCAATAAATATTTGTTGAAGG + Intronic
1129924410 15:79350106-79350128 GCTCAGTGAATATTTGTTGAAGG + Intronic
1129974035 15:79806011-79806033 GCTCAATAAATATTTGTTGAAGG - Intergenic
1132930788 16:2458187-2458209 GCAGAGTAAACAGAAGTGGATGG - Exonic
1133532059 16:6664473-6664495 GCTCAGTAAGAACTTGTGGATGG + Intronic
1133558347 16:6926653-6926675 GCTGAGTAAACATATGTGCATGG + Intronic
1134296754 16:12952897-12952919 GTTCAATAAACATTTGTGAAAGG - Intronic
1134768857 16:16786507-16786529 GCTTAATAAATATTTGTGGAAGG - Intergenic
1135893454 16:26377272-26377294 ACTCAGTAAACATTTATGGAAGG + Intergenic
1136015777 16:27399929-27399951 GCTCAATAAATATTAGGGGGAGG + Intergenic
1137918493 16:52459367-52459389 GCTCAGTAAATATTCATTGAAGG + Intronic
1139072313 16:63397879-63397901 GCTCAGTAAATATTAATGATGGG - Intergenic
1140016640 16:71193189-71193211 GCTCAGTAAATAATTGTTGAAGG + Intronic
1140067442 16:71623866-71623888 GCTCAATAAAGATTTGTGGAAGG + Intergenic
1141097846 16:81175454-81175476 GCTCTGTAAATATTTGTGGAAGG + Intergenic
1141425997 16:83944995-83945017 GCTCCATAAACATTAATTGAAGG - Intronic
1141499634 16:84434927-84434949 GCTAAGCAAACATTTGTGGAGGG - Intronic
1141773411 16:86105478-86105500 GCTCAGGAAGCATGAGTGGGAGG + Intergenic
1142936393 17:3336837-3336859 ACTCAGAAAACATTAATTGATGG - Intergenic
1143557294 17:7669825-7669847 GCTCAGTAAACATATTTGCATGG - Intronic
1144046023 17:11455474-11455496 ACTCAGTAAATATTTGTGAAAGG - Intronic
1144300641 17:13920491-13920513 GCTCAGTAAACCTTGATGGATGG - Intergenic
1145971625 17:28959676-28959698 GGTCAGTAGACACCAGTGGATGG - Exonic
1147254215 17:39172511-39172533 GCTCAATAAACATTTGTTCAAGG + Intergenic
1149652334 17:58283744-58283766 GCTCAGTAAATACTTGTTGAAGG - Intergenic
1151157901 17:72139704-72139726 CCTCAATAAACATCAGTGGCAGG + Intergenic
1153244333 18:3058661-3058683 GCTCAGTAAACATTTGTTGAAGG + Intergenic
1155410191 18:25535607-25535629 GCTCAGCAAATATTTGTTGATGG + Intergenic
1157471251 18:47990891-47990913 GCTCAATAAATATTTGTGAATGG + Intergenic
1157787042 18:50493284-50493306 TCTCAGTAAACATCCATGGAAGG - Intergenic
1159149506 18:64503438-64503460 CCTCAGTAAACATGAGTTGAAGG - Intergenic
1159522280 18:69541589-69541611 GCTCAGTATATATTCATGGAAGG - Intronic
1161049001 19:2152120-2152142 ATTCAGTAAACATTTGTCGAAGG + Intronic
1161470920 19:4456445-4456467 GGTCTGTAAGCAATAGTGGAAGG - Intronic
1162542357 19:11305163-11305185 GCTCAATAAATATTAGTGGGAGG - Intronic
1162854951 19:13461036-13461058 GCTCAAAAAACACCAGTGGAAGG + Intronic
1163250282 19:16122698-16122720 GCTCAGGAAAGACTTGTGGAGGG + Intronic
1165162016 19:33821997-33822019 ACTCAGTAGATATTTGTGGAAGG - Intergenic
1165464093 19:35962043-35962065 TCTCAGCAAACATTTGTGGAAGG + Intergenic
1165892732 19:39124291-39124313 GCTCAGTAAACATTGGTGGAAGG - Intergenic
1165903819 19:39181452-39181474 GCCCAGCAATCATTAGAGGAAGG + Intronic
1167640231 19:50677632-50677654 GCTCAATAAATATTTGTAGAAGG + Intronic
1167658007 19:50778990-50779012 GCTCGGTAAACATAACTGGATGG - Intergenic
1167707934 19:51092851-51092873 GTTCAGTAAACCTTTGTGGAAGG + Intergenic
926858140 2:17279936-17279958 ACTCACTAAACAGTAGTGAAAGG - Intergenic
927038729 2:19206582-19206604 GCTCAGTAAATGTTTGTGGAAGG + Intergenic
927272747 2:21230703-21230725 GGTCAGAAAACATTAGTAGCTGG - Intergenic
927313283 2:21654022-21654044 GCTCAGTAAATATTAATTGGTGG - Intergenic
928040686 2:27873350-27873372 ACTCAGTGAACATTTGTGGAGGG - Intronic
929044590 2:37777418-37777440 GCTCAGTAAATAGTTGTTGATGG - Intergenic
931080138 2:58759892-58759914 GCTCAGTAAATATTTATGAAAGG - Intergenic
932693785 2:73936581-73936603 AATCAGTAACCATAAGTGGAAGG + Intronic
933265343 2:80175506-80175528 GCTCACTAAATATTTGTTGAAGG - Intronic
934945251 2:98536585-98536607 GCTCAATAAATATTTATGGAAGG + Intronic
935651244 2:105384013-105384035 GCTCATAAAACATGCGTGGAAGG + Intronic
937647022 2:124276951-124276973 GCTCAGCAAACATCAGTGGGTGG + Intronic
938123244 2:128648466-128648488 GCTGATAAAACATTTGTGGATGG + Intergenic
939582857 2:143971220-143971242 GCTCAGTAAATGTGAGAGGAAGG - Intronic
939883840 2:147659704-147659726 TCTCAATAAATATTAGTTGAAGG + Intergenic
940591727 2:155737295-155737317 GTTCAGAAAACATTGGTTGAAGG + Intergenic
942164964 2:173232805-173232827 GCTCAATAAAGATTTGTTGATGG - Intronic
942443712 2:176063277-176063299 GCTCAGTAGTTATTTGTGGATGG - Intergenic
943836590 2:192521773-192521795 ATTCAGTAAACATTAATTGAGGG - Intergenic
944035581 2:195290784-195290806 GGTCAGTAACCCTTAGAGGAAGG + Intergenic
945018254 2:205543081-205543103 GCTCAGTAAATATTAATGAACGG + Intronic
946100030 2:217312532-217312554 GCTCAGTAAATATTTGTGCAAGG - Intronic
947037760 2:225878880-225878902 ACTCAACAAACATTTGTGGAAGG - Intergenic
1168840772 20:908673-908695 CCTCAATAAACAGTGGTGGAAGG + Intronic
1169097794 20:2918480-2918502 GCTCTGTTAACAGTAGGGGATGG + Intronic
1170394705 20:15913870-15913892 ACTCAGTAAATATTTGTGGGTGG + Intronic
1170467122 20:16632310-16632332 GCTAAATAAACATTTGTTGAGGG - Intergenic
1170699047 20:18686910-18686932 GCTAAATAAATATTTGTGGAAGG - Intronic
1172192396 20:33069786-33069808 CCTCAGTAAGGGTTAGTGGACGG + Intronic
1172195420 20:33088517-33088539 ACTCAGTAAATGTTTGTGGAAGG - Intronic
1172197039 20:33099074-33099096 GCTCAGTAAACATTGGTCACAGG + Intronic
1172257417 20:33531201-33531223 GCTCAGGAAATATTTGTTGAAGG + Intronic
1172304098 20:33869459-33869481 GCTCAGGAAACATCTGTGGAAGG - Intergenic
1172811345 20:37650293-37650315 GCTCAATAAATATTGGTTGAAGG - Intergenic
1172877159 20:38171455-38171477 GCTCAGGAAACACTAGAGGTGGG + Intergenic
1172988573 20:39014252-39014274 GCTCAGTCAAGATTTGTAGAAGG + Intronic
1173354007 20:42270160-42270182 ACTTAGTAAGCATTAGTAGAAGG + Intronic
1173818353 20:46004790-46004812 GCTCAGTACAGATAAGTGGGAGG + Intergenic
1174503500 20:51002402-51002424 GCTCAATAAACATTTATTGAAGG - Intergenic
1174738224 20:52985690-52985712 GCTCAATAAATATTATTTGAAGG + Intronic
1176589053 21:8622649-8622671 CCTCAATAAACATTTGTTGAAGG + Intergenic
1180271877 22:10599646-10599668 CCTCAATAAACATTTGTTGAAGG + Intergenic
1180587620 22:16906846-16906868 GCTGTGTAAACATTTGTGGAAGG - Intergenic
1181728242 22:24826467-24826489 GCTCAGTAAGCATTAGCTGCTGG + Intronic
1181754754 22:25015964-25015986 GCTCAATAAAAAATAGTTGAGGG - Intronic
1182850108 22:33466470-33466492 GCTCAATAAATATTTGTTGAAGG + Intronic
1182898373 22:33877089-33877111 GCTCAGTAAATACTTGCGGAAGG - Intronic
1182928772 22:34153264-34153286 CCTCAGCAAACATTTGTTGAAGG - Intergenic
1183225580 22:36547726-36547748 GCTCAGTAAACATGAGTGATGGG - Intergenic
1183243168 22:36673416-36673438 TATCAGTAAACCTTTGTGGATGG + Intronic
1183588818 22:38768316-38768338 GCTCAATAAATATTTGTGGCTGG + Intronic
1185284576 22:49994529-49994551 ACTCAGTAAACATTGGTCCAGGG - Exonic
949138265 3:599120-599142 CCTCAATAAACATTTGTTGAAGG - Intergenic
950015848 3:9754499-9754521 GCTCAGAAAACATGTGTAGAGGG + Intronic
950936298 3:16842836-16842858 ACTGAGTAAACATCAGTTGAAGG - Intronic
951234793 3:20221510-20221532 GCTCAATAAATATTTGTTGATGG + Intergenic
951427981 3:22571152-22571174 GCTCAATAAACATCTGTGGATGG + Intergenic
951557074 3:23931665-23931687 GCCCAATAAGTATTAGTGGAAGG + Intronic
952577614 3:34794024-34794046 GCTCATCAAACATTAGTGATGGG + Intergenic
954919886 3:54180897-54180919 GCTCAGTAAACATTTGCAAAAGG + Intronic
955569067 3:60283944-60283966 GTTCATTAAACATTAATGGCAGG + Intronic
956147291 3:66203606-66203628 GCTCATTAAAAATTAGAGCATGG + Intronic
959081491 3:101806389-101806411 ACTCAGTAAATATTTTTGGAGGG - Intronic
961089430 3:124097258-124097280 GCTCAATAAATATTTGTTGAAGG + Intronic
963300018 3:143587180-143587202 GTTCAATAAATATTTGTGGATGG - Intronic
966005418 3:175005521-175005543 GCTCAGTAAATATTTGTTAAAGG + Intronic
966218109 3:177523201-177523223 GCAATGTAAACATTAGTGGGGGG + Intergenic
968981752 4:3853888-3853910 GCTCAGTAAACATCAGCAGGAGG - Intergenic
969219482 4:5750427-5750449 GCTCATTAAACATTGGCTGAAGG - Intronic
969263883 4:6051583-6051605 GCTCAGAAAACAATTGTGAATGG - Intronic
969458873 4:7317130-7317152 GCTCAGTCAACATTAATAAATGG + Intronic
970083640 4:12320190-12320212 GCAAAGGAAACATTAGTGGAAGG - Intergenic
971066346 4:23036862-23036884 GCTCAGTAAATATCTGTGGAGGG + Intergenic
972156205 4:36165760-36165782 GCTCAGTAAATATTTCTTGAAGG - Intronic
972169015 4:36322293-36322315 GCTCAATAAACATGAGTGAATGG + Intronic
973783673 4:54315150-54315172 GCTCAGTAAATATTTGTTGCAGG + Intergenic
974164916 4:58189794-58189816 GATCAATAGACATGAGTGGAAGG + Intergenic
974894221 4:67919495-67919517 GCTCAGTAAATATTTGTGGAAGG - Intronic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
978910128 4:114052541-114052563 GCTCATTAACCAAAAGTGGAAGG + Intergenic
980113177 4:128654081-128654103 GCTCAGTAAATATTAATTGAAGG + Intergenic
980965743 4:139519017-139519039 GCTTAGTAAACATCAGTTGAGGG - Intronic
981918001 4:150055970-150055992 GCTCAGTACATATTTGAGGAAGG - Intergenic
983712406 4:170735223-170735245 GCTGAGTGAATATAAGTGGATGG + Intergenic
984559458 4:181251528-181251550 ATTCAGTAAACATTTATGGAGGG - Intergenic
984981782 4:185289158-185289180 GCTCAGTAAACACTGCTGAATGG - Intronic
986444967 5:7813277-7813299 GCTCAGTGAATATTTATGGAAGG + Intronic
986764784 5:10915548-10915570 GCTCAGTTAAAATAAATGGAAGG - Intergenic
986998687 5:13636846-13636868 GCTTAGTAATCATTACTTGAAGG - Intergenic
987263289 5:16225455-16225477 GCTCAGTAAGTATTTGTTGAAGG - Intergenic
987921141 5:24283394-24283416 ACTCAGTATGGATTAGTGGATGG - Intergenic
991353360 5:65743220-65743242 GCTTAGTAAATATTTGTTGATGG - Intronic
992666500 5:79014837-79014859 GCTCTGTAAATATTTGTTGAAGG - Intronic
993338207 5:86688290-86688312 GCTCTGTAAACATTAGTTGTTGG + Intergenic
994282638 5:97924174-97924196 GCTCAGTGAATATTTGTTGAAGG - Intergenic
995064269 5:107842460-107842482 GCTCAATAAACATTTGTGCATGG - Intergenic
996798858 5:127380196-127380218 GCTTAATAAATATTTGTGGATGG + Intronic
997037058 5:130205367-130205389 GCTCAGAAAACTTTATAGGAGGG - Intergenic
997824127 5:137091237-137091259 GCTCAGTAAATGTTGGTGGAAGG - Intronic
998191128 5:140025443-140025465 GCTCAATAAACATTAACTGAGGG - Intronic
999420306 5:151436017-151436039 GCTCAATAAACAGTAGTAGCAGG - Intergenic
999748432 5:154609270-154609292 GCTCAGTAGTAATTTGTGGAAGG + Intergenic
1001089141 5:168724344-168724366 GCTCAGGAAACTGAAGTGGATGG - Intronic
1001568106 5:172713479-172713501 GCACAGCAAACATTCGTGGATGG + Intergenic
1001569093 5:172718497-172718519 GCTCAGTGAAGATAGGTGGATGG + Intergenic
1001713385 5:173795337-173795359 GGTCAGTAAACATTCGTTGAAGG - Intergenic
1002390371 5:178906964-178906986 CCTCAGAAAACTTTACTGGAAGG - Intronic
1002987779 6:2207655-2207677 GCTCAGTAAATATTTGTTGAAGG + Intronic
1003801322 6:9671399-9671421 ACTCAGTAACCATGAGTGGTAGG - Intronic
1006519610 6:34563632-34563654 GCTCAATAAACATTTGCTGAAGG - Intergenic
1007068049 6:39013160-39013182 TCTCAGTAAACATTTCTAGAAGG - Intronic
1007361050 6:41356018-41356040 GCACTGTAAACATTTGTGTATGG - Intergenic
1007711204 6:43825519-43825541 GGTCAGGTAAAATTAGTGGAGGG + Intergenic
1007776171 6:44225659-44225681 CCTCAGTAAATATTTGTCGAAGG + Intronic
1008004121 6:46391887-46391909 GCTCAGTAATTATTGGTTGAAGG + Intronic
1008479143 6:51966680-51966702 GCTCAATAAACATTTGTTGAAGG - Intronic
1009582177 6:65550055-65550077 GCTCAGTGAAAAATAATGGATGG - Intronic
1010738100 6:79465711-79465733 GCTAAGTAAACATTGGTAGATGG + Intergenic
1012215371 6:96576259-96576281 GCTCAGTAAATATTTGCAGATGG - Intronic
1013324798 6:109034086-109034108 GGTCAGTAAATATTAGTTGTGGG + Intronic
1014092050 6:117415003-117415025 GCTCAGTCAACATTTGCTGAAGG - Intronic
1015037621 6:128676327-128676349 TCTCAATAAATATTTGTGGAGGG - Intergenic
1016156483 6:140816165-140816187 TCTCAGTAAATGTTAGTTGAAGG + Intergenic
1016631003 6:146231284-146231306 CCTCAGTAAAATTGAGTGGAAGG - Intronic
1016807115 6:148222810-148222832 GCTTAGTAAACATATTTGGAGGG - Intergenic
1017305952 6:152918499-152918521 GTTCAGTAAATATTTGTGGAGGG - Intergenic
1019401103 7:854465-854487 GCTCAGTAGCCATGAGTGGCTGG + Intronic
1020458496 7:8401683-8401705 GCTCAGTAAAAATGGGAGGAGGG - Intergenic
1023766488 7:43516226-43516248 GCTCAGTAAATATGTGTGGAAGG + Intronic
1024096832 7:45988696-45988718 GTTCAGTAAGCATTTGTGGATGG - Intergenic
1028730474 7:94142321-94142343 GCTCAATAAATATTTGTGGAAGG - Intergenic
1029663451 7:101978942-101978964 GCACAGTAAACATCTGTTGATGG + Intronic
1032976523 7:137230496-137230518 CTTCAGTAAAAAGTAGTGGAAGG + Intronic
1035459829 7:159031834-159031856 GTTCAGGAAACAGTAGAGGACGG + Exonic
1035673589 8:1438811-1438833 GCTCAGGAAACATTTGTGGATGG - Intergenic
1036794431 8:11745057-11745079 GCTCAGTAAATATTTGTTGGTGG + Intronic
1037054779 8:14426084-14426106 ACTCAATAAACATTTGTTGAAGG - Intronic
1037397558 8:18459106-18459128 GCTCAATAAATATTTGTTGACGG + Intergenic
1038897930 8:31807474-31807496 GCTCACTAAATATTTATGGAAGG + Intronic
1038952493 8:32431256-32431278 ACTCAGGAAACAGTACTGGATGG + Intronic
1039157065 8:34572548-34572570 ACTCAGTTTACATTAGTGAATGG - Intergenic
1039397043 8:37235315-37235337 GCTCAATACATATTTGTGGAAGG + Intergenic
1039822935 8:41149779-41149801 GTTCAGTAAATATTAGTTGAAGG + Intergenic
1041480756 8:58317270-58317292 GCTCAGTACAGCTTAGAGGAGGG + Intergenic
1041643882 8:60230892-60230914 ACTCAATAAATATTTGTGGATGG - Intronic
1041738720 8:61137297-61137319 GCAGAGTAAACATTCATGGAGGG + Intronic
1044010958 8:86994129-86994151 GCTGAGCAAAGATTTGTGGATGG - Intronic
1045311969 8:101010604-101010626 GCTCAATAAACATGAGCAGAGGG - Intergenic
1045499112 8:102731652-102731674 GCTCAATAAGTATTTGTGGAAGG + Intergenic
1046810268 8:118525518-118525540 GCTCAACAAATATTAGTTGAAGG + Intronic
1047314498 8:123720127-123720149 GCTCAGTAAACATTTGACAATGG + Intronic
1048062394 8:130934085-130934107 GCTCAATAAACATTTGTTGATGG + Intronic
1048720353 8:137317034-137317056 GCTGAGAAAACATTGGTGAAGGG - Intergenic
1048731517 8:137446823-137446845 GATCAGTAAACATTTTTGCAAGG - Intergenic
1048806241 8:138244007-138244029 GCTCAAGAAACATTTGTGGAAGG + Intronic
1050049251 9:1581976-1581998 GCTCAATAAACATTTATGTATGG - Intergenic
1050258542 9:3817407-3817429 GCTCTGTAAATATTAGAGGCAGG - Intergenic
1050445660 9:5719515-5719537 GCTCAGTAAATGTTTGTAGAAGG + Intronic
1051357968 9:16256968-16256990 GCTCAATAAACATTTGTGAAAGG + Intronic
1052252537 9:26415800-26415822 ACTCAGTAAATATTAGTAGAAGG + Intergenic
1055757001 9:79568897-79568919 GCTCAGTAAATATTTGTTGATGG - Intergenic
1056034469 9:82588970-82588992 GCTCAGCACAAATGAGTGGATGG - Intergenic
1057218241 9:93241553-93241575 TCTCAGTAAAAAGAAGTGGAGGG + Intronic
1057738385 9:97688952-97688974 GCTGAGTAAACAGTAGTGATAGG + Intronic
1058717970 9:107739304-107739326 GCTCAGTAAACATTTGAAGGAGG - Intergenic
1059407256 9:114108839-114108861 GCTTAGCAAACATGGGTGGAAGG + Intergenic
1060207269 9:121689515-121689537 GACCAGTAAACACTAGTGGGAGG - Intronic
1060264770 9:122105071-122105093 GGTCAGCAAACTTTGGTGGATGG - Intergenic
1060880007 9:127111449-127111471 GCTCAATAAATATTTGTTGATGG + Intronic
1061907489 9:133706150-133706172 GCTCAGTGAACATGCGTGAACGG - Intronic
1186126808 X:6423127-6423149 GTTAAGTAAACTTTAGTGCATGG - Intergenic
1188326030 X:28801907-28801929 GCTCAATAAATATTTGTGAAAGG - Intronic
1188649983 X:32620668-32620690 ACTCAGTAAAGATTTGTTGAAGG - Intronic
1191731920 X:64345493-64345515 GCTGAGAAAACATTTGTGGTAGG - Intronic
1193540377 X:82764372-82764394 GCTCAACAAACATTTGTTGAAGG + Intergenic
1194984160 X:100471942-100471964 GCTCGGTAAATATTTGTTGAAGG + Intergenic
1195121587 X:101759205-101759227 GCTCCGTAAAGATTTGAGGAGGG + Intergenic
1196174099 X:112621421-112621443 ACTCAGTTAACATTTGTTGAAGG - Intergenic
1196417325 X:115485433-115485455 GCTCAGTAAATATTTGTTGAAGG + Intergenic
1196675101 X:118411891-118411913 ACTCAGAAAACATTTGTTGAAGG - Intronic
1196718554 X:118832592-118832614 TCTCAGTAAATATTTGTGGCTGG + Intergenic
1197085982 X:122476046-122476068 ATTCAGTAAATATTTGTGGAGGG + Intergenic
1199590691 X:149465640-149465662 CCTCAGGAAACATTGGTAGAAGG - Intergenic
1199756827 X:150872847-150872869 GCTCAGCAAACAGTAGAGGATGG + Intronic
1200742558 Y:6869930-6869952 GCTCTGTAAAGAATAGTGGGTGG - Intronic
1201461222 Y:14226612-14226634 GTTCAATAAACATTGGTTGAAGG + Intergenic