ID: 1114736595

View in Genome Browser
Species Human (GRCh38)
Location 14:25049516-25049538
Sequence GGCCCATGCCATCGCGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 68}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114736587_1114736595 9 Left 1114736587 14:25049484-25049506 CCACACTGGGAGCCTCGGGGCAG 0: 1
1: 0
2: 1
3: 35
4: 251
Right 1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG 0: 1
1: 0
2: 1
3: 7
4: 68
1114736586_1114736595 10 Left 1114736586 14:25049483-25049505 CCCACACTGGGAGCCTCGGGGCA 0: 1
1: 0
2: 1
3: 16
4: 144
Right 1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG 0: 1
1: 0
2: 1
3: 7
4: 68
1114736578_1114736595 21 Left 1114736578 14:25049472-25049494 CCCCGAGCTCCCCCACACTGGGA 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG 0: 1
1: 0
2: 1
3: 7
4: 68
1114736591_1114736595 -3 Left 1114736591 14:25049496-25049518 CCTCGGGGCAGCATTCTCGGGGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG 0: 1
1: 0
2: 1
3: 7
4: 68
1114736583_1114736595 12 Left 1114736583 14:25049481-25049503 CCCCCACACTGGGAGCCTCGGGG 0: 1
1: 0
2: 1
3: 16
4: 210
Right 1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG 0: 1
1: 0
2: 1
3: 7
4: 68
1114736580_1114736595 19 Left 1114736580 14:25049474-25049496 CCGAGCTCCCCCACACTGGGAGC 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG 0: 1
1: 0
2: 1
3: 7
4: 68
1114736579_1114736595 20 Left 1114736579 14:25049473-25049495 CCCGAGCTCCCCCACACTGGGAG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG 0: 1
1: 0
2: 1
3: 7
4: 68
1114736585_1114736595 11 Left 1114736585 14:25049482-25049504 CCCCACACTGGGAGCCTCGGGGC 0: 1
1: 0
2: 0
3: 22
4: 186
Right 1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG 0: 1
1: 0
2: 1
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114736595 Original CRISPR GGCCCATGCCATCGCGGGGA CGG Intronic
900283788 1:1890066-1890088 GGCCCATTCATTCGCGGGGCCGG + Intronic
900822001 1:4897039-4897061 GACCCCTGCCATCCCCGGGAAGG + Intergenic
902238091 1:15070517-15070539 GGCTCATGCTGTGGCGGGGAAGG - Intronic
903893115 1:26583418-26583440 GGCCCATGGCATCCCAGGCATGG + Intergenic
905394375 1:37657684-37657706 GCACCCTGCCATCCCGGGGAAGG + Intergenic
917744760 1:177996597-177996619 GGCACATGCCATCTCGGTGTGGG + Intergenic
922097113 1:222451987-222452009 GGCCCTTGCCTTAGCAGGGAAGG - Intergenic
922797963 1:228350948-228350970 GGCCCAGGCCTGCCCGGGGATGG + Intronic
1070742762 10:78913541-78913563 GGACCATGCCATCTGGGGGAGGG - Intergenic
1075733496 10:124650278-124650300 GGCCCAGGTCATCGCGGGACAGG + Intronic
1104049756 12:125187172-125187194 GGCCCAAGGCAGGGCGGGGAGGG - Intronic
1105690923 13:22838391-22838413 GGCCCATGACAACCAGGGGAGGG + Intergenic
1110271135 13:73592200-73592222 AGCCCCTGCCATCGCAGGAAGGG + Intergenic
1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG + Intronic
1121613600 14:95298060-95298082 GGCCCATCCCAGTGCGGGCAAGG - Intronic
1122214440 14:100193732-100193754 GGCCCATGGCAGCCCTGGGAGGG + Intergenic
1129456139 15:75677040-75677062 GGCCTTTGCCATCACGGTGAGGG - Exonic
1131096130 15:89655313-89655335 GGCCCAGGCCTGCGCGAGGAGGG + Intronic
1133207016 16:4239961-4239983 TGCCCATGCCAGGACGGGGAAGG - Intronic
1135522051 16:23185087-23185109 GGCGTATGCCATAGCGGTGAAGG + Intronic
1136277706 16:29188725-29188747 TGCCCGTGCCATCGAGGGGACGG + Intergenic
1140115313 16:72036640-72036662 GGCCCATTCCATCCAGGGGTGGG + Intergenic
1142082080 16:88154767-88154789 TGCCCGTGCCATCGAGGGGACGG + Intergenic
1142243766 16:88959073-88959095 GGACCTTGGCATCGCGAGGATGG - Intronic
1144991648 17:19237639-19237661 GGCGCATGCCCTGGCGGGGCTGG - Intronic
1146919590 17:36701615-36701637 GGCCCATGCAGTCACAGGGAGGG - Intergenic
1147652591 17:42070998-42071020 GGCCCATGGAATAGCTGGGATGG - Intergenic
1147782997 17:42957083-42957105 GGCCCATCCCAGCACTGGGAGGG - Intronic
1152533752 17:80938179-80938201 GGCCCATGCCAGAACAGGGAGGG - Intronic
1152855507 17:82663096-82663118 GGGCCATGCCCTCGCTGGGCTGG - Intronic
1160527937 18:79548179-79548201 GGCCCAGGCCAGTGCGGAGAAGG - Intergenic
1163733227 19:18962231-18962253 GGTCCCTTCCATCTCGGGGATGG - Intergenic
1164979646 19:32604144-32604166 GGCCCTTGGCATCGCCGGGCTGG - Intronic
1165317527 19:35065793-35065815 AGCCCATGTCATCCCGGGGTGGG + Intronic
1166391132 19:42409564-42409586 GGCCTCTGCCCTCCCGGGGACGG + Intronic
925883394 2:8371098-8371120 GGCCCAGGCCATGCCAGGGAAGG + Intergenic
927945273 2:27131789-27131811 GGCCCATGGCATTGTGGTGACGG - Exonic
944058425 2:195547330-195547352 GGCCCATGGCAGCGCGGGACTGG - Intergenic
946401677 2:219471788-219471810 GGCCCATGCCATCCCGGGCCTGG - Intronic
1174298863 20:49568105-49568127 GGCCCAAGCCATCGCGGGGCTGG + Exonic
1175830027 20:61959046-61959068 GGACCATGCCAGCGCAGGGAAGG - Intronic
1175919151 20:62441915-62441937 CGCCCTTGCCCTCGCTGGGAAGG - Intergenic
1179879659 21:44288041-44288063 GGCCCATGTCATGGGGGGGTGGG + Intronic
1179998841 21:44986113-44986135 GGCCCAGGCCAGCCCGGGCAGGG + Intergenic
1182353426 22:29711299-29711321 GGCTCCTGCCATCTGGGGGATGG - Intergenic
1183307468 22:37090261-37090283 GGCCCAGGCCATTCCGAGGATGG + Intronic
953619969 3:44524717-44524739 GTCACCTGCCATCGAGGGGATGG - Intergenic
955168501 3:56539551-56539573 GGCCCATGCCATTGAGATGATGG - Intergenic
962355413 3:134689909-134689931 GGCCCCTTCCATAGCGAGGAAGG + Intronic
966756754 3:183378407-183378429 GGCCCAGGTCTTCGAGGGGATGG - Intronic
968807759 4:2786704-2786726 AGCCCATGTCATCGGGGAGAGGG + Intergenic
968832802 4:2941867-2941889 GGCCCATGCAACCACGGGCAAGG + Intronic
969059373 4:4423015-4423037 GGTCCATGCCACCTCAGGGATGG - Intronic
974892345 4:67896979-67897001 GGCCCCTGCCATCCCAGGAAGGG + Intergenic
984835108 4:184011999-184012021 GGCCCCTGCCCTCGCTGTGAGGG - Intronic
987847484 5:23305125-23305147 GGAACATGACATCGCGGAGATGG - Intergenic
997622068 5:135305493-135305515 GGCCCATGCCAACTGGGGAAGGG - Intronic
1003034318 6:2629852-2629874 GGCTCATGCCATTGTGGGGCTGG - Intronic
1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG + Exonic
1007172300 6:39872358-39872380 GGCCGATGCCTTCCCGGGGGAGG - Intronic
1018735716 6:166685932-166685954 GGCCCATGCCCTAGGAGGGAGGG + Intronic
1019149891 6:169998134-169998156 AGCCCATTCCATGGAGGGGACGG + Intergenic
1020088883 7:5326394-5326416 GGCCCTTCTCATCGCGGGGGTGG - Intronic
1020283643 7:6664115-6664137 AGCCCAAGCCTCCGCGGGGAAGG - Intergenic
1023545290 7:41312077-41312099 GGCCCAAGCCACCCCAGGGAGGG - Intergenic
1025205425 7:56990727-56990749 GGCCCTTCTCATCGCGGGGGTGG + Intergenic
1025666515 7:63586212-63586234 GGCCCTTCTCATCGCGGGGGTGG - Intergenic
1026831850 7:73615228-73615250 AGGCCATGCCATCTCGTGGAAGG - Intronic
1035968682 8:4223456-4223478 AGACCATGCCATGGCTGGGAAGG + Intronic
1038425675 8:27462434-27462456 GGCCAATGCCATGGCAGGGGCGG + Intronic
1042195404 8:66227822-66227844 GGCCCATGCCATAGCTTTGAAGG - Intergenic
1044973778 8:97644341-97644363 GGCCGCTGCCACCGCGGGGAGGG - Exonic
1049508675 8:143017290-143017312 AGCCCCTGCCATGGCAGGGATGG + Intergenic
1050097055 9:2077704-2077726 GGCTCATGCCATCTCGGAGAGGG + Exonic
1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG + Intronic
1061807667 9:133145385-133145407 GGCCCAGGCCATGCCGGGGCGGG - Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic