ID: 1114736679

View in Genome Browser
Species Human (GRCh38)
Location 14:25049866-25049888
Sequence CAGGCTGCACGGTAGGACCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114736679_1114736692 27 Left 1114736679 14:25049866-25049888 CCCCGGTCCTACCGTGCAGCCTG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736679_1114736686 6 Left 1114736679 14:25049866-25049888 CCCCGGTCCTACCGTGCAGCCTG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114736679 Original CRISPR CAGGCTGCACGGTAGGACCG GGG (reversed) Exonic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
906065405 1:42976994-42977016 GAGGCTGCACGGGAGCACTGGGG + Intergenic
1062805395 10:416034-416056 CATGCTGTACGGTAGCCCCGTGG + Intronic
1063636437 10:7787617-7787639 CAGGCTGCCCGCTGGGCCCGGGG + Intronic
1066477891 10:35765315-35765337 CAGGCTGCACGGTGGGAAGACGG - Intergenic
1067235622 10:44446177-44446199 CAGGCTGCACGGCAGGAGGTGGG - Intergenic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1077327326 11:1969410-1969432 CAGGCTGCCCGGAAGGAGGGTGG - Intronic
1077410094 11:2399925-2399947 CATCCTGCCCGGGAGGACCGGGG + Intergenic
1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG + Exonic
1078470296 11:11580973-11580995 CAGGCTTCAGGGTGGCACCGTGG - Intronic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1082768156 11:57184780-57184802 CAGGATGCAGGGTGGGAACGTGG - Intronic
1083881114 11:65548711-65548733 CAGGCTGCATGGCAGGAGTGAGG - Intronic
1085058028 11:73419281-73419303 CAAGCTGCACTGTGGGACCAAGG - Intronic
1086338771 11:85826230-85826252 CAGGATGCACAGGAGGACTGAGG + Intergenic
1202810308 11_KI270721v1_random:24590-24612 CAGGCTGCCCGGAAGGAGGGTGG - Intergenic
1095478609 12:42611019-42611041 CTGGCCGCACGGTAGGGGCGGGG + Intergenic
1097250277 12:57628678-57628700 CAGGCTGAACGGCAGGCCAGAGG - Intronic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1103846099 12:123902920-123902942 TCGGCTGCAGGGTAGGACAGGGG - Exonic
1104311121 12:127655149-127655171 CCGGCTGCCCGGGAGGAGCGTGG - Intergenic
1105745995 13:23377392-23377414 CAGGCTCCACGGAAAAACCGAGG - Intronic
1112490493 13:99858988-99859010 CAGGCTGGAAGGAAGGACCCGGG - Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1117513164 14:56473004-56473026 CAGGCTGGATGGAAGGACTGTGG + Intergenic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1118911686 14:70066968-70066990 CAGGATGCATGATAGGACCTGGG - Intronic
1122364000 14:101183578-101183600 CAGCCTTCACACTAGGACCGCGG + Intergenic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1124658340 15:31526173-31526195 AAGGACGCACGGGAGGACCGTGG - Intronic
1124662370 15:31560765-31560787 CAGGCTGAACTGGAGGACAGTGG - Intronic
1132350558 15:101137213-101137235 CAGGCAACACGGTGGGACTGAGG + Intergenic
1132748754 16:1447711-1447733 CAGGCTGCAAGACAGGCCCGCGG + Exonic
1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG + Intronic
1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG + Intronic
1138174968 16:54888823-54888845 CAGGCAGGAAGGTAGGACAGAGG + Intergenic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1144574979 17:16423680-16423702 CAAGCTGCACGGTAGGGCAGAGG - Exonic
1144757999 17:17691819-17691841 CAGGCTGGAAGGTAGCACCTGGG - Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG + Intronic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1159152579 18:64538811-64538833 CAGGCAGCAAGGTGGGACTGGGG + Intergenic
1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG + Intronic
1165421573 19:35724674-35724696 CAGGCTGCAGGGTAGGTTTGCGG - Exonic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
946186341 2:217982837-217982859 CAAGCAGCAAGGTAGGACCCAGG - Intronic
948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG + Intergenic
1168830891 20:844842-844864 CAGGCGGCAAGGTAGGGCGGGGG - Exonic
1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG + Intronic
1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG + Intronic
1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG + Exonic
1175709517 20:61208050-61208072 CAGGCTGGATGTTAGGTCCGGGG - Intergenic
1175889642 20:62310515-62310537 GAGGCTGCACGGGAGGCCCCTGG - Exonic
1180110386 21:45644640-45644662 CAGGCTGCTCTGAAGGACGGTGG - Intronic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
958508353 3:95012010-95012032 CAGTCTGCATGGTAGTACGGTGG + Intergenic
983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG + Intronic
987114084 5:14712954-14712976 CAGGGTGCACGGTGCGACCCTGG - Exonic
995914812 5:117232192-117232214 AAGGCTGCAGGGTAGAACAGTGG + Intergenic
997264347 5:132486439-132486461 CAGGCTGCAGGGTTGGTCGGAGG - Intronic
1002565915 5:180113002-180113024 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002565938 5:180113059-180113081 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG + Intronic
1002566186 5:180113725-180113747 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG + Intergenic
1004864551 6:19838958-19838980 CAGACTGCACGGGAGGACACCGG - Intronic
1006387434 6:33739166-33739188 CAGGCTGCACTGAAGGCCCAGGG - Exonic
1017923420 6:158890486-158890508 GAGGATGCACTGTGGGACCGTGG + Intronic
1023632829 7:42180572-42180594 AAGGCTGGAGGGTAGGACCCAGG + Intronic
1027787191 7:82594998-82595020 CAGACTGAAGGGTAGGACTGTGG + Intergenic
1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG + Intronic
1034052879 7:148001289-148001311 CAGGCTGAAGGCTAGGACCCAGG - Intronic
1034344778 7:150379477-150379499 GAGGCAGCACGGGAGGAGCGGGG - Intronic
1035673656 8:1439373-1439395 CAGGGTACACGGCAGGACCGTGG - Intergenic
1043769743 8:84183416-84183438 CAGGCAGCGGGGAAGGACCGAGG - Intronic
1048977457 8:139680884-139680906 CAGGCTGCTGGGCAGGACCATGG - Intronic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG + Intergenic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1062426110 9:136507014-136507036 CACGCGGCACGGCAGGGCCGGGG - Intronic
1190514537 X:51209134-51209156 AAGGCTGCAGGGTAGAACTGAGG + Intergenic
1192048613 X:67702464-67702486 CAGGCTGCAAGGTATGATCTGGG - Intronic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199852152 X:151732426-151732448 CAGGCTTCACCCTAGGACCAGGG + Intergenic
1200143371 X:153913139-153913161 CAGGCGGGAGGGGAGGACCGTGG + Intronic