ID: 1114736686

View in Genome Browser
Species Human (GRCh38)
Location 14:25049895-25049917
Sequence GCCCCTGCCGTGCCAGTGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114736680_1114736686 5 Left 1114736680 14:25049867-25049889 CCCGGTCCTACCGTGCAGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736684_1114736686 -5 Left 1114736684 14:25049877-25049899 CCGTGCAGCCTGGCTCGCGCCCC 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736676_1114736686 13 Left 1114736676 14:25049859-25049881 CCCCTCGCCCCGGTCCTACCGTG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736672_1114736686 28 Left 1114736672 14:25049844-25049866 CCTGACCGCCTGGCTCCCCTCGC 0: 1
1: 0
2: 2
3: 27
4: 233
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736682_1114736686 4 Left 1114736682 14:25049868-25049890 CCGGTCCTACCGTGCAGCCTGGC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736673_1114736686 23 Left 1114736673 14:25049849-25049871 CCGCCTGGCTCCCCTCGCCCCGG 0: 1
1: 0
2: 4
3: 61
4: 471
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736683_1114736686 -1 Left 1114736683 14:25049873-25049895 CCTACCGTGCAGCCTGGCTCGCG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736678_1114736686 11 Left 1114736678 14:25049861-25049883 CCTCGCCCCGGTCCTACCGTGCA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736679_1114736686 6 Left 1114736679 14:25049866-25049888 CCCCGGTCCTACCGTGCAGCCTG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736675_1114736686 20 Left 1114736675 14:25049852-25049874 CCTGGCTCCCCTCGCCCCGGTCC 0: 1
1: 0
2: 2
3: 54
4: 562
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736671_1114736686 29 Left 1114736671 14:25049843-25049865 CCCTGACCGCCTGGCTCCCCTCG 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113
1114736677_1114736686 12 Left 1114736677 14:25049860-25049882 CCCTCGCCCCGGTCCTACCGTGC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114736686 Original CRISPR GCCCCTGCCGTGCCAGTGCG CGG Exonic
900158840 1:1213939-1213961 GTCCCTGGAGTGCCCGTGCGTGG + Intronic
900181494 1:1313001-1313023 GGCCCTGCCAGCCCAGTGCGGGG + Intronic
900308331 1:2021713-2021735 GCTCCTACCGTGCCAGCTCGCGG + Intronic
904006605 1:27366366-27366388 GCCCCTGCGCTGCCTGCGCGAGG - Exonic
904322834 1:29707966-29707988 GCCAGTGCCGTGCCTGTGCCTGG + Intergenic
904598864 1:31662920-31662942 GCCCCTGCCATGCCAGCCCCTGG - Intronic
907411089 1:54283807-54283829 GCCCCTGCCTTGCCCCTGCCCGG + Intronic
1062824627 10:558565-558587 CACCCTGCCATGCCAGTGCGGGG + Intronic
1065312310 10:24428200-24428222 GCCCCAGCCATGCCTGGGCGAGG - Intronic
1069034205 10:63630477-63630499 GCTGGTGCCGTGCCAGTGGGCGG + Intergenic
1076732877 10:132447069-132447091 ACCCCTGACCTGCCAGTGCCAGG - Intronic
1077021986 11:421028-421050 GCCGCTGGCGTGGCACTGCGGGG + Exonic
1077105602 11:841132-841154 GCCCCTGCCGTTCCTATCCGGGG + Intronic
1077318065 11:1928081-1928103 GGTCCTGCCTTGCCAGTGCCTGG - Intronic
1083258366 11:61510006-61510028 GCCCCAGCCCTGCCTGTGCCCGG - Exonic
1084484994 11:69443080-69443102 GCCCCTTCCTGGCCAGTGCTGGG - Intergenic
1084548941 11:69829189-69829211 GCACCTGCCTAGCCAGTGGGCGG - Intergenic
1085238316 11:75032038-75032060 GCCCCTCCTGCCCCAGTGCGTGG - Intergenic
1085454676 11:76659110-76659132 GCCCCGGCTGTGCCAGGGTGAGG - Exonic
1087876508 11:103364867-103364889 TCCCCTGCAGTGCCTGTGGGTGG - Intronic
1089256231 11:117195747-117195769 GCCCTTGCCCTGCCAGAGCAGGG + Intronic
1089557074 11:119320687-119320709 GCCCCTTCCCTGCCAGGGGGTGG + Intronic
1094841058 12:34342892-34342914 GCCCCTGCCGCGCAAGCGCGGGG + Intergenic
1096611138 12:52802607-52802629 GCCCCTGCCGTGCTCTTGGGTGG + Intergenic
1097750226 12:63344527-63344549 GCCCCAGCCATGGCAGTGCTTGG + Intergenic
1103415695 12:120740418-120740440 GGCCCTGGCCAGCCAGTGCGGGG + Intergenic
1104989935 12:132619364-132619386 GCCCCTGCCGTGCCTGCGGGCGG + Intronic
1108450908 13:50562041-50562063 GCCCCTCCCCTGACAGTGCCTGG - Intronic
1112656132 13:101453963-101453985 GCCCCGGCCGTGGCACAGCGCGG - Exonic
1113847180 13:113399083-113399105 ACCCCTGCTGTGCCCGTGGGTGG - Intergenic
1113899524 13:113788481-113788503 GCCTCTGCTGCGCCAGTGCCAGG - Intronic
1114736686 14:25049895-25049917 GCCCCTGCCGTGCCAGTGCGCGG + Exonic
1121243889 14:92449189-92449211 GACCCTTCCGTGCCATTGCTGGG + Exonic
1122130957 14:99604340-99604362 GCCCCCGCCGTCCCCCTGCGCGG + Intergenic
1128212444 15:65912129-65912151 GCCCCCCACATGCCAGTGCGTGG + Intronic
1128308133 15:66613530-66613552 GCCCTTGACGTGCCAGAGCATGG + Intronic
1132345297 15:101104580-101104602 GCGCTTGCCATGCCATTGCGGGG - Intergenic
1133344044 16:5058455-5058477 GCCCCCGCCGTGCCAGGGGAAGG - Intronic
1134677801 16:16102749-16102771 GACCCTGCCCTGCCAGTGGGAGG + Intronic
1141548263 16:84786833-84786855 GCCCCTGCCATGCCTGGGGGAGG + Intergenic
1142408917 16:89906395-89906417 GCCCCTGCCGTGGCGGGGCTGGG - Intronic
1143688319 17:8537963-8537985 GCCCCTGCCTTGCCAGACTGTGG - Intronic
1143862397 17:9900357-9900379 GCCCCTGCCCTGTCAGTCAGTGG - Intronic
1146398403 17:32486424-32486446 GTCCCTGCCCTGGCAGCGCGCGG - Intergenic
1147251334 17:39154229-39154251 GCCTCCGCCCTGCCATTGCGAGG + Intronic
1157597951 18:48875238-48875260 GCCCCTGCCTGGCCAGTGACAGG - Intergenic
1159885108 18:73896354-73896376 GGCCCTGCCAGCCCAGTGCGGGG - Intergenic
1160028226 18:75236358-75236380 GCCCCTTCCCTCCCAGTGAGAGG - Intronic
1160157101 18:76442359-76442381 GCCGCTGCCGGGCCCCTGCGCGG + Exonic
1160777196 19:861734-861756 CCCCCTGCCCTGGCAGCGCGTGG + Exonic
1160909959 19:1469791-1469813 GCCACGGCCCTGCCACTGCGGGG + Exonic
1160990944 19:1860098-1860120 GCCCCCGGCATGCCAGTGCCCGG - Intronic
1161363300 19:3863645-3863667 GCCCCTGCCCTGCTAGTTCAGGG - Intronic
1161698420 19:5782862-5782884 GGCGCTGCCTTGCCAGTCCGCGG + Intergenic
1161960372 19:7519851-7519873 GGCGCGGCCGTACCAGTGCGCGG + Exonic
1162736028 19:12747606-12747628 GCCTCTGCTGAGCCAGTGCTGGG - Intronic
1162781134 19:13007511-13007533 GCCCTTGCCATGCCAGGGCCTGG - Intronic
1163289729 19:16371332-16371354 GCCCCTCCCGTACCTGTGTGTGG - Intronic
1163710152 19:18841733-18841755 GCCCCTGCCTTCCCAGCCCGGGG - Intronic
1166369127 19:42291641-42291663 GCCCCTAGCATGTCAGTGCGGGG + Exonic
1167782285 19:51606727-51606749 GCCCCTGCTGTGCAGGTGCAGGG - Intergenic
925736536 2:6968880-6968902 GTCCCTGCAGTGGCAGTGAGAGG + Intronic
925898372 2:8490350-8490372 GCCCATGCAGGGCCAGTGCCAGG + Intergenic
927515370 2:23668934-23668956 GCCCCTGCTGTGCCACTTCCGGG - Intronic
927679715 2:25131668-25131690 GACCCTGCCCTGCCTGCGCGCGG + Intronic
928432691 2:31234063-31234085 GGCCCTGCCTTGCCAGTACTAGG + Intergenic
929818975 2:45258374-45258396 GCCCGGGCCCTGCCAGTGCTGGG + Intergenic
929829423 2:45335052-45335074 TCCCCTGCAGTGTCAGTGCTGGG - Intergenic
932758968 2:74427187-74427209 ACCCCTGCTTTGCCAGTGCTTGG + Exonic
934566763 2:95345879-95345901 GCCCTTGCCCTGCCCGTGCGTGG + Intronic
944336187 2:198538192-198538214 GCCCCTGGCTTCCCAGTGCTGGG - Intronic
948912132 2:241009978-241010000 GCCCCCGCTGTGCCTGTGGGAGG + Intronic
1169209853 20:3759801-3759823 GTCCCTGCCGTTCCACTGTGGGG - Intronic
1171461721 20:25301778-25301800 GCCCATGTCCTGCCAGTGCAGGG + Intronic
1171462561 20:25307147-25307169 GCCCCTGCCATGCCAGTCTGTGG - Intronic
1174080084 20:47964691-47964713 GTCCCTGCCGTGTGAGTCCGGGG - Intergenic
1176092158 20:63323003-63323025 GGCTCTGCCGGGCCAGTGTGGGG - Intronic
1176138326 20:63534712-63534734 GCCCCTGCCCTCCCAGGGAGGGG + Intronic
1179951536 21:44711420-44711442 GCCCCTGCCTTACCTGTGCAGGG + Exonic
1180020527 21:45122609-45122631 GCCCCTGGCATGTCAGTGGGCGG + Intronic
1184102343 22:42347446-42347468 GCCCCTTCAGTCCCAGTGGGTGG - Intergenic
1184483978 22:44765309-44765331 GCCCCTGCATTGCCAGGGAGGGG + Intronic
949533202 3:4977566-4977588 TCCCCTGCCCTGCAAGTTCGGGG - Intergenic
949856484 3:8466652-8466674 GCCCCTGTGGTGCAAGTGTGGGG - Intergenic
952884944 3:38006479-38006501 GCACCTGCCCTGCCATTGCCCGG - Exonic
954364516 3:50138982-50139004 GCCCCTGACCTACCAGTGAGAGG - Intergenic
963292221 3:143503623-143503645 GCCCATGCCTTGGCAGTGCCAGG + Intronic
967833821 3:193944206-193944228 GCCCTTGCTGTGCCTGTGAGAGG + Intergenic
968091446 3:195900751-195900773 CCCCGTGCCGTGACAGTGCATGG - Intronic
968481635 4:835612-835634 GCCCCGGCTGTGCCACTGCCAGG + Intergenic
969720579 4:8891273-8891295 GCCCCTGCACTGCCAGTTCCAGG + Intergenic
976804387 4:89029520-89029542 GCCCCTGCCGTTCAAGTTCTTGG + Exonic
983904623 4:173169750-173169772 GCCCCTGCTGTGGCAGTGCTCGG + Intronic
984966276 4:185143166-185143188 GCACCTGCCCAGCCAATGCGCGG + Intergenic
985754527 5:1705087-1705109 GTCCCTGCCTTCCCAGTGCGGGG - Intergenic
985784935 5:1888368-1888390 GCCCCAGCCAGGCCAGTGCCTGG - Intergenic
1003178926 6:3775575-3775597 GCTCCTGGCGTGTCAGTGAGGGG + Intergenic
1003392988 6:5729345-5729367 GCCTCTGCTGTGCCCGTGGGAGG - Intronic
1006171512 6:32095966-32095988 GCCCCTCCCGTGGCAGTTGGAGG + Intronic
1007897551 6:45378027-45378049 GCGCCCGCACTGCCAGTGCGGGG - Intronic
1008556611 6:52678809-52678831 GCTACTGCCCTGCCAGTGGGAGG + Intronic
1011640540 6:89412560-89412582 CCCCCTCCCCTGCCTGTGCGGGG - Intergenic
1015551795 6:134419588-134419610 ACCCCTGCCCTGCCAGTCCGGGG + Intergenic
1019841834 7:3453704-3453726 GCACCTGTAGTGCCAGTGAGTGG - Intronic
1021998267 7:26201394-26201416 GCCCCTGCGGTGCGAGGGTGTGG - Exonic
1030273688 7:107696868-107696890 GCCCCTGCTCTGCCTGTGCTTGG + Intronic
1032467651 7:132156506-132156528 GCTCCTGCCGTGCCAGGGGCTGG + Intronic
1033613015 7:142984190-142984212 GCCCCACCCCTGCCAGTGCCTGG - Intergenic
1034222733 7:149459248-149459270 GCCCTGGCCGTGCTAGTGAGAGG - Intronic
1034561922 7:151885874-151885896 GCCCCTGCCGTCCCAGTAAGTGG - Intergenic
1034987758 7:155527864-155527886 GCCGCTGCTGGGCCAGTGCAGGG + Intronic
1035153180 7:156892559-156892581 GCCCCTGGGGTCCCAGAGCGCGG + Intronic
1035767582 8:2119542-2119564 GACCCTGCCTTGCCAGGGAGTGG - Intronic
1038550247 8:28461260-28461282 GCCCCAGCAGTTCCAGTGCTTGG - Intronic
1049676401 8:143891161-143891183 GCCCCTCCCTGGCCAGTGTGCGG - Intergenic
1049828618 8:144685826-144685848 GCCGCCGCCGGCCCAGTGCGCGG + Intergenic
1049921523 9:369267-369289 GCCCCTGGCATGCCACTGCCAGG + Intronic
1053489181 9:38487060-38487082 GCCCCTCCCATGCCAGGGCAGGG + Intergenic
1054929171 9:70618576-70618598 GCCCCTGCAGTACCTGTGCGTGG + Intronic
1056242984 9:84668306-84668328 GTCCCTGCCCGGCCGGTGCGCGG - Intergenic
1056705167 9:88946169-88946191 GCCCCTGCCCTGCCAATACTTGG + Intergenic
1057276508 9:93678486-93678508 GCCCCTGCCCTGCCAGTCCCAGG - Exonic
1060881530 9:127121627-127121649 GCCCCTGCTGTCCCCTTGCGGGG + Intronic
1061139247 9:128754225-128754247 GCCCCTGCAGTGTGCGTGCGTGG - Intronic
1187245987 X:17553272-17553294 GGCCCTGCCCTCCCAGTGGGAGG + Intronic
1200058333 X:153472955-153472977 GCCTCAGCCGTGTCAGTGCTTGG + Intronic