ID: 1114736692

View in Genome Browser
Species Human (GRCh38)
Location 14:25049916-25049938
Sequence GGCACGCGTCCCAGAGCACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114736687_1114736692 -3 Left 1114736687 14:25049896-25049918 CCCCTGCCGTGCCAGTGCGCGGC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736684_1114736692 16 Left 1114736684 14:25049877-25049899 CCGTGCAGCCTGGCTCGCGCCCC 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736688_1114736692 -4 Left 1114736688 14:25049897-25049919 CCCTGCCGTGCCAGTGCGCGGCA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736690_1114736692 -9 Left 1114736690 14:25049902-25049924 CCGTGCCAGTGCGCGGCACGCGT 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736685_1114736692 8 Left 1114736685 14:25049885-25049907 CCTGGCTCGCGCCCCTGCCGTGC 0: 1
1: 0
2: 2
3: 19
4: 236
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736679_1114736692 27 Left 1114736679 14:25049866-25049888 CCCCGGTCCTACCGTGCAGCCTG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736683_1114736692 20 Left 1114736683 14:25049873-25049895 CCTACCGTGCAGCCTGGCTCGCG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736680_1114736692 26 Left 1114736680 14:25049867-25049889 CCCGGTCCTACCGTGCAGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736689_1114736692 -5 Left 1114736689 14:25049898-25049920 CCTGCCGTGCCAGTGCGCGGCAC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66
1114736682_1114736692 25 Left 1114736682 14:25049868-25049890 CCGGTCCTACCGTGCAGCCTGGC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114736692 Original CRISPR GGCACGCGTCCCAGAGCACG AGG Exonic
902673565 1:17992815-17992837 GCCACCCTTCCCAGAGCACAGGG + Intergenic
906722732 1:48021009-48021031 GGCAGGCTTCCCAGAGAAGGTGG + Intergenic
913371963 1:118109408-118109430 GGCACGCGTGCCACAACACCCGG - Intronic
920380688 1:205533013-205533035 GGCACTCGTCCCACAGCCTGGGG - Intergenic
1070920585 10:80183138-80183160 GGCACTCGTCCCAGGTCACTGGG + Intronic
1076169861 10:128309961-128309983 GGCAGGCTTCCCAGAACAGGGGG + Intergenic
1080896638 11:36453743-36453765 GCCACGGGTCCCAGGGCACAGGG + Intronic
1083317872 11:61827733-61827755 CGCACGCGCCCCGGAGCGCGCGG + Intronic
1083806810 11:65079302-65079324 TGCACGTCTCCCAGAGCACACGG + Intronic
1090518629 11:127455229-127455251 GGCACACCTCCCAGAACACCTGG + Intergenic
1090636708 11:128694350-128694372 GGCCCGCGTCCCGGAAGACGTGG + Intronic
1092094276 12:5828402-5828424 GGCTGGCGTCCCCGAGCAGGTGG - Intronic
1102579722 12:113878681-113878703 AGCAAACGTCCCATAGCACGGGG + Intronic
1104730678 12:131103740-131103762 GGCAGGCGTCTCGGAGGACGGGG + Intronic
1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG + Exonic
1128843649 15:70871465-70871487 GGCACACCTCCCAGACCAGGTGG + Intronic
1130296289 15:82648624-82648646 GGCAGGCGTCCTAGGGCACCTGG + Intronic
1130613507 15:85381419-85381441 TGCACGGGTCCCAGAGCGCGTGG - Intronic
1132958504 16:2609418-2609440 GGCACGTGTCTCCGAGCACCGGG + Intergenic
1132971116 16:2689514-2689536 GGCACGTGTCTCCGAGCACCGGG + Intronic
1136315978 16:29454960-29454982 GGAAGGCGTCCCAGAGGAGGCGG + Exonic
1136430555 16:30194302-30194324 GGAAGGCGTCCCAGAGGAGGCGG + Exonic
1136458536 16:30395768-30395790 GGCACGCCGCCCTGAGCAAGGGG - Exonic
1137594067 16:49712307-49712329 GGCTCGCGTGCCTGAGCAGGTGG + Intronic
1138248214 16:55482769-55482791 GCCAGGGGTCCCAGAGCACTGGG - Intronic
1142128448 16:88421510-88421532 GGGACGCGTCCCCGAGCCCCTGG + Intergenic
1142504110 17:352050-352072 GCCACGCGTCTTAGAGCAGGAGG - Intronic
1146176118 17:30667605-30667627 GACACGTGTCCCAGAGGACCTGG + Intergenic
1146349575 17:32083715-32083737 GACACGTGTCCCAGAGGACCTGG + Intergenic
1152503091 17:80726137-80726159 AGCAGGCTTCCCAGAGCAGGCGG + Intronic
1156222837 18:35070930-35070952 GGAATGCTTCCCAGAGCAGGTGG - Intronic
1159954163 18:74507668-74507690 GGCAGGCCTCACAGAGGACGAGG - Intronic
1160425218 18:78774550-78774572 GGCAGGCGCCCCAGAGCCCTCGG + Intergenic
1160499336 18:79394508-79394530 GGCACGCGCCCCAGAGCACCGGG - Intergenic
1160755950 19:757273-757295 GGCACTCCGCCCAGAGGACGGGG + Exonic
1161569403 19:5022290-5022312 GGCACAAGACCCAGAGCACCTGG - Intronic
1161925325 19:7294873-7294895 GACACTCGTCCCAGAGCGCGTGG + Intergenic
1162506770 19:11090368-11090390 GGCCCCCGTCCCGGAGCACGCGG - Intronic
1162982705 19:14249302-14249324 GACACGTGTCCCAGAGGACCTGG - Intergenic
1163235243 19:16025927-16025949 GGCACACTTCCCAGGACACGGGG + Intergenic
1165894377 19:39132678-39132700 GGCACCTGTCTCAGACCACGAGG - Intronic
931516332 2:63052484-63052506 GGCAGGCCGCCCAGAGCATGAGG - Intronic
934619176 2:95793705-95793727 GGCACAGCTCCCAGAGCAGGAGG - Intergenic
934641715 2:96030852-96030874 GGCACAGCTCCCAGAGCAGGAGG + Intronic
937259535 2:120576732-120576754 GGCAAACGCCCCAGAGCAGGCGG - Intergenic
948199671 2:236120458-236120480 GGCACGCCTGGCAGAGGACGGGG + Intronic
1178951638 21:36990315-36990337 GGCCCGCGTTCCCGAGCGCGCGG - Intergenic
1181319057 22:21990768-21990790 GGCACCAAACCCAGAGCACGCGG - Intergenic
953848298 3:46446051-46446073 GACACGAGTCCCAGGTCACGAGG + Intronic
969874801 4:10128161-10128183 AGCACATGTCTCAGAGCACGGGG + Intergenic
1007362880 6:41371460-41371482 GGCCAGCGTCCCAGAGCCCAGGG - Intergenic
1019282942 7:209668-209690 GGCAGGCGTCCCACAGGAAGGGG + Intronic
1019524953 7:1476667-1476689 GGCAAAGGTTCCAGAGCACGAGG + Intronic
1020070342 7:5223231-5223253 GGCACGGGCTCCAGAGCCCGAGG - Intronic
1024558938 7:50627719-50627741 TGCACCCTTCCCAGAACACGAGG + Intronic
1024834255 7:53496794-53496816 GGCACGAATCCAAGAGCAAGAGG - Intergenic
1026740521 7:72975922-72975944 GGCAGGCTTCCCAGAGGAGGCGG + Intergenic
1026987253 7:74562267-74562289 GGCAGGTGTCCCAGGGCAGGTGG + Intronic
1027103211 7:75389149-75389171 GGCAGGCTTCCCAGAGGAGGCGG - Intergenic
1034551311 7:151822484-151822506 GGGACATGTCTCAGAGCACGCGG + Intronic
1049082906 8:140457179-140457201 GCCGCGCGTCCCAGACCCCGCGG + Intronic
1049218586 8:141418682-141418704 GGCCCGCGGCCCACAGCACGGGG - Intronic
1049224193 8:141441834-141441856 GGCACCCTTCCCAGGGCAGGGGG - Intergenic
1049435639 8:142584992-142585014 GGCAGGCCTCCCAGAGGAAGGGG + Intergenic
1049545739 8:143229707-143229729 GACACGCGACCCAGGGGACGGGG - Intergenic
1053550625 9:39075817-39075839 GGCATGCAGCCCACAGCACGTGG - Intronic
1053814733 9:41895916-41895938 GGCATGCGGTCCACAGCACGTGG - Intronic
1054615863 9:67291525-67291547 GGCATGCGGTCCACAGCACGTGG + Intergenic
1057828188 9:98387099-98387121 GGCAGGCTTCCCAGAGGAGGTGG + Intronic
1062129676 9:134885708-134885730 GGCCGACGTCCCACAGCACGGGG - Intronic
1062399306 9:136365494-136365516 GGAACGCCTCCCAGACCTCGGGG + Intronic
1190304042 X:49072475-49072497 CGCCCGCGACCCAGAGCACCAGG + Exonic