ID: 1114740117

View in Genome Browser
Species Human (GRCh38)
Location 14:25088234-25088256
Sequence CTGTGGGAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114740117 Original CRISPR CTGTGGGAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr