ID: 1114744901

View in Genome Browser
Species Human (GRCh38)
Location 14:25136567-25136589
Sequence AAGGGCAAGCAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2291
Summary {0: 3, 1: 77, 2: 306, 3: 637, 4: 1268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114744892_1114744901 24 Left 1114744892 14:25136520-25136542 CCAGGTTCATCTCACTGGGACTA 0: 15
1: 388
2: 1240
3: 1189
4: 1325
Right 1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG 0: 3
1: 77
2: 306
3: 637
4: 1268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114744901 Original CRISPR AAGGGCAAGCAGAAGCAGGG TGG Intergenic
Too many off-targets to display for this crispr