ID: 1114751919

View in Genome Browser
Species Human (GRCh38)
Location 14:25214242-25214264
Sequence CCTTAAGCACTGCAGGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114751919_1114751924 18 Left 1114751919 14:25214242-25214264 CCAGATTCCTGCAGTGCTTAAGG No data
Right 1114751924 14:25214283-25214305 TTAGACATCTTCTGAAATCTGGG No data
1114751919_1114751922 -9 Left 1114751919 14:25214242-25214264 CCAGATTCCTGCAGTGCTTAAGG No data
Right 1114751922 14:25214256-25214278 TGCTTAAGGCACTGCTCACTAGG No data
1114751919_1114751925 28 Left 1114751919 14:25214242-25214264 CCAGATTCCTGCAGTGCTTAAGG No data
Right 1114751925 14:25214293-25214315 TCTGAAATCTGGGCCAGTTGTGG No data
1114751919_1114751923 17 Left 1114751919 14:25214242-25214264 CCAGATTCCTGCAGTGCTTAAGG No data
Right 1114751923 14:25214282-25214304 GTTAGACATCTTCTGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114751919 Original CRISPR CCTTAAGCACTGCAGGAATC TGG (reversed) Intergenic
No off target data available for this crispr