ID: 1114755244

View in Genome Browser
Species Human (GRCh38)
Location 14:25252548-25252570
Sequence ATTCAATTTCTCTCCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114755244_1114755253 30 Left 1114755244 14:25252548-25252570 CCAGAAAAGGAGAGAAATTGAAT No data
Right 1114755253 14:25252601-25252623 TATACGGGTGGTGTGTATGTAGG No data
1114755244_1114755252 18 Left 1114755244 14:25252548-25252570 CCAGAAAAGGAGAGAAATTGAAT No data
Right 1114755252 14:25252589-25252611 GTGGATGGAGCTTATACGGGTGG No data
1114755244_1114755250 14 Left 1114755244 14:25252548-25252570 CCAGAAAAGGAGAGAAATTGAAT No data
Right 1114755250 14:25252585-25252607 GAAGGTGGATGGAGCTTATACGG No data
1114755244_1114755251 15 Left 1114755244 14:25252548-25252570 CCAGAAAAGGAGAGAAATTGAAT No data
Right 1114755251 14:25252586-25252608 AAGGTGGATGGAGCTTATACGGG No data
1114755244_1114755245 -8 Left 1114755244 14:25252548-25252570 CCAGAAAAGGAGAGAAATTGAAT No data
Right 1114755245 14:25252563-25252585 AATTGAATTTGACATGTACCAGG No data
1114755244_1114755247 -1 Left 1114755244 14:25252548-25252570 CCAGAAAAGGAGAGAAATTGAAT No data
Right 1114755247 14:25252570-25252592 TTTGACATGTACCAGGAAGGTGG No data
1114755244_1114755246 -4 Left 1114755244 14:25252548-25252570 CCAGAAAAGGAGAGAAATTGAAT No data
Right 1114755246 14:25252567-25252589 GAATTTGACATGTACCAGGAAGG No data
1114755244_1114755248 3 Left 1114755244 14:25252548-25252570 CCAGAAAAGGAGAGAAATTGAAT No data
Right 1114755248 14:25252574-25252596 ACATGTACCAGGAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114755244 Original CRISPR ATTCAATTTCTCTCCTTTTC TGG (reversed) Intergenic
No off target data available for this crispr