ID: 1114755249

View in Genome Browser
Species Human (GRCh38)
Location 14:25252581-25252603
Sequence ATAAGCTCCATCCACCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114755249_1114755260 16 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755260 14:25252620-25252642 TAGGGCAGCTGGCGGGTGGCGGG No data
1114755249_1114755265 23 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755265 14:25252627-25252649 GCTGGCGGGTGGCGGGTGGGGGG No data
1114755249_1114755266 27 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755266 14:25252631-25252653 GCGGGTGGCGGGTGGGGGGTAGG No data
1114755249_1114755262 20 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755262 14:25252624-25252646 GCAGCTGGCGGGTGGCGGGTGGG No data
1114755249_1114755263 21 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755263 14:25252625-25252647 CAGCTGGCGGGTGGCGGGTGGGG No data
1114755249_1114755257 9 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755257 14:25252613-25252635 GTGTATGTAGGGCAGCTGGCGGG No data
1114755249_1114755261 19 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755261 14:25252623-25252645 GGCAGCTGGCGGGTGGCGGGTGG No data
1114755249_1114755254 -2 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755254 14:25252602-25252624 ATACGGGTGGTGTGTATGTAGGG No data
1114755249_1114755264 22 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755264 14:25252626-25252648 AGCTGGCGGGTGGCGGGTGGGGG No data
1114755249_1114755258 12 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755258 14:25252616-25252638 TATGTAGGGCAGCTGGCGGGTGG No data
1114755249_1114755259 15 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755259 14:25252619-25252641 GTAGGGCAGCTGGCGGGTGGCGG No data
1114755249_1114755256 8 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755256 14:25252612-25252634 TGTGTATGTAGGGCAGCTGGCGG No data
1114755249_1114755253 -3 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755253 14:25252601-25252623 TATACGGGTGGTGTGTATGTAGG No data
1114755249_1114755255 5 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114755249 Original CRISPR ATAAGCTCCATCCACCTTCC TGG (reversed) Intergenic
No off target data available for this crispr