ID: 1114755253

View in Genome Browser
Species Human (GRCh38)
Location 14:25252601-25252623
Sequence TATACGGGTGGTGTGTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114755244_1114755253 30 Left 1114755244 14:25252548-25252570 CCAGAAAAGGAGAGAAATTGAAT No data
Right 1114755253 14:25252601-25252623 TATACGGGTGGTGTGTATGTAGG No data
1114755249_1114755253 -3 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755253 14:25252601-25252623 TATACGGGTGGTGTGTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114755253 Original CRISPR TATACGGGTGGTGTGTATGT AGG Intergenic
No off target data available for this crispr