ID: 1114755257

View in Genome Browser
Species Human (GRCh38)
Location 14:25252613-25252635
Sequence GTGTATGTAGGGCAGCTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114755249_1114755257 9 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755257 14:25252613-25252635 GTGTATGTAGGGCAGCTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114755257 Original CRISPR GTGTATGTAGGGCAGCTGGC GGG Intergenic
No off target data available for this crispr