ID: 1114755264

View in Genome Browser
Species Human (GRCh38)
Location 14:25252626-25252648
Sequence AGCTGGCGGGTGGCGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114755249_1114755264 22 Left 1114755249 14:25252581-25252603 CCAGGAAGGTGGATGGAGCTTAT No data
Right 1114755264 14:25252626-25252648 AGCTGGCGGGTGGCGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114755264 Original CRISPR AGCTGGCGGGTGGCGGGTGG GGG Intergenic
No off target data available for this crispr