ID: 1114756845

View in Genome Browser
Species Human (GRCh38)
Location 14:25269360-25269382
Sequence CTGTGGGGATGGAGGGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114756837_1114756845 2 Left 1114756837 14:25269335-25269357 CCTTTGGTGGGGCTTGCTATGGC No data
Right 1114756845 14:25269360-25269382 CTGTGGGGATGGAGGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114756845 Original CRISPR CTGTGGGGATGGAGGGATTG TGG Intergenic
No off target data available for this crispr