ID: 1114756997

View in Genome Browser
Species Human (GRCh38)
Location 14:25270406-25270428
Sequence TTGAGATGGAGATGTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114756997_1114757002 30 Left 1114756997 14:25270406-25270428 CCAGGACAACATCTCCATCTCAA No data
Right 1114757002 14:25270459-25270481 ATTACATATTTACAGTGCCAGGG No data
1114756997_1114757001 29 Left 1114756997 14:25270406-25270428 CCAGGACAACATCTCCATCTCAA No data
Right 1114757001 14:25270458-25270480 GATTACATATTTACAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114756997 Original CRISPR TTGAGATGGAGATGTTGTCC TGG (reversed) Intergenic
No off target data available for this crispr