ID: 1114756998

View in Genome Browser
Species Human (GRCh38)
Location 14:25270420-25270442
Sequence GACTCAGTAGGATCTTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114756998_1114757002 16 Left 1114756998 14:25270420-25270442 CCATCTCAAGATCCTACTGAGTC No data
Right 1114757002 14:25270459-25270481 ATTACATATTTACAGTGCCAGGG No data
1114756998_1114757005 28 Left 1114756998 14:25270420-25270442 CCATCTCAAGATCCTACTGAGTC No data
Right 1114757005 14:25270471-25270493 CAGTGCCAGGGATTGGGATGTGG No data
1114756998_1114757003 21 Left 1114756998 14:25270420-25270442 CCATCTCAAGATCCTACTGAGTC No data
Right 1114757003 14:25270464-25270486 ATATTTACAGTGCCAGGGATTGG No data
1114756998_1114757004 22 Left 1114756998 14:25270420-25270442 CCATCTCAAGATCCTACTGAGTC No data
Right 1114757004 14:25270465-25270487 TATTTACAGTGCCAGGGATTGGG No data
1114756998_1114757001 15 Left 1114756998 14:25270420-25270442 CCATCTCAAGATCCTACTGAGTC No data
Right 1114757001 14:25270458-25270480 GATTACATATTTACAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114756998 Original CRISPR GACTCAGTAGGATCTTGAGA TGG (reversed) Intergenic