ID: 1114756999

View in Genome Browser
Species Human (GRCh38)
Location 14:25270432-25270454
Sequence CATGGCAGATGAGACTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114756999_1114757005 16 Left 1114756999 14:25270432-25270454 CCTACTGAGTCTCATCTGCCATG No data
Right 1114757005 14:25270471-25270493 CAGTGCCAGGGATTGGGATGTGG No data
1114756999_1114757002 4 Left 1114756999 14:25270432-25270454 CCTACTGAGTCTCATCTGCCATG No data
Right 1114757002 14:25270459-25270481 ATTACATATTTACAGTGCCAGGG No data
1114756999_1114757004 10 Left 1114756999 14:25270432-25270454 CCTACTGAGTCTCATCTGCCATG No data
Right 1114757004 14:25270465-25270487 TATTTACAGTGCCAGGGATTGGG No data
1114756999_1114757001 3 Left 1114756999 14:25270432-25270454 CCTACTGAGTCTCATCTGCCATG No data
Right 1114757001 14:25270458-25270480 GATTACATATTTACAGTGCCAGG No data
1114756999_1114757007 25 Left 1114756999 14:25270432-25270454 CCTACTGAGTCTCATCTGCCATG No data
Right 1114757007 14:25270480-25270502 GGATTGGGATGTGGATATCTTGG No data
1114756999_1114757003 9 Left 1114756999 14:25270432-25270454 CCTACTGAGTCTCATCTGCCATG No data
Right 1114757003 14:25270464-25270486 ATATTTACAGTGCCAGGGATTGG No data
1114756999_1114757008 28 Left 1114756999 14:25270432-25270454 CCTACTGAGTCTCATCTGCCATG No data
Right 1114757008 14:25270483-25270505 TTGGGATGTGGATATCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114756999 Original CRISPR CATGGCAGATGAGACTCAGT AGG (reversed) Intergenic
No off target data available for this crispr