ID: 1114757000

View in Genome Browser
Species Human (GRCh38)
Location 14:25270450-25270472
Sequence TGTAAATATGTAATCTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114757000_1114757005 -2 Left 1114757000 14:25270450-25270472 CCATGTAAGATTACATATTTACA No data
Right 1114757005 14:25270471-25270493 CAGTGCCAGGGATTGGGATGTGG No data
1114757000_1114757008 10 Left 1114757000 14:25270450-25270472 CCATGTAAGATTACATATTTACA No data
Right 1114757008 14:25270483-25270505 TTGGGATGTGGATATCTTGGAGG No data
1114757000_1114757004 -8 Left 1114757000 14:25270450-25270472 CCATGTAAGATTACATATTTACA No data
Right 1114757004 14:25270465-25270487 TATTTACAGTGCCAGGGATTGGG No data
1114757000_1114757003 -9 Left 1114757000 14:25270450-25270472 CCATGTAAGATTACATATTTACA No data
Right 1114757003 14:25270464-25270486 ATATTTACAGTGCCAGGGATTGG No data
1114757000_1114757007 7 Left 1114757000 14:25270450-25270472 CCATGTAAGATTACATATTTACA No data
Right 1114757007 14:25270480-25270502 GGATTGGGATGTGGATATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114757000 Original CRISPR TGTAAATATGTAATCTTACA TGG (reversed) Intergenic
No off target data available for this crispr