ID: 1114757005

View in Genome Browser
Species Human (GRCh38)
Location 14:25270471-25270493
Sequence CAGTGCCAGGGATTGGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114756999_1114757005 16 Left 1114756999 14:25270432-25270454 CCTACTGAGTCTCATCTGCCATG No data
Right 1114757005 14:25270471-25270493 CAGTGCCAGGGATTGGGATGTGG No data
1114757000_1114757005 -2 Left 1114757000 14:25270450-25270472 CCATGTAAGATTACATATTTACA No data
Right 1114757005 14:25270471-25270493 CAGTGCCAGGGATTGGGATGTGG No data
1114756998_1114757005 28 Left 1114756998 14:25270420-25270442 CCATCTCAAGATCCTACTGAGTC No data
Right 1114757005 14:25270471-25270493 CAGTGCCAGGGATTGGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114757005 Original CRISPR CAGTGCCAGGGATTGGGATG TGG Intergenic
No off target data available for this crispr