ID: 1114758018

View in Genome Browser
Species Human (GRCh38)
Location 14:25282192-25282214
Sequence AAGGGAAATACAGTGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114758018_1114758024 4 Left 1114758018 14:25282192-25282214 CCAGCAAACACTGTATTTCCCTT No data
Right 1114758024 14:25282219-25282241 GCCTGTTGACTTAAAGGTAGGGG 0: 7
1: 6
2: 1
3: 11
4: 94
1114758018_1114758021 -2 Left 1114758018 14:25282192-25282214 CCAGCAAACACTGTATTTCCCTT No data
Right 1114758021 14:25282213-25282235 TTCTTAGCCTGTTGACTTAAAGG 0: 189
1: 199
2: 128
3: 93
4: 280
1114758018_1114758026 5 Left 1114758018 14:25282192-25282214 CCAGCAAACACTGTATTTCCCTT No data
Right 1114758026 14:25282220-25282242 CCTGTTGACTTAAAGGTAGGGGG 0: 172
1: 195
2: 121
3: 82
4: 194
1114758018_1114758022 2 Left 1114758018 14:25282192-25282214 CCAGCAAACACTGTATTTCCCTT No data
Right 1114758022 14:25282217-25282239 TAGCCTGTTGACTTAAAGGTAGG 0: 175
1: 204
2: 126
3: 69
4: 122
1114758018_1114758023 3 Left 1114758018 14:25282192-25282214 CCAGCAAACACTGTATTTCCCTT No data
Right 1114758023 14:25282218-25282240 AGCCTGTTGACTTAAAGGTAGGG No data
1114758018_1114758027 22 Left 1114758018 14:25282192-25282214 CCAGCAAACACTGTATTTCCCTT No data
Right 1114758027 14:25282237-25282259 AGGGGGAACCCAAAGTGTCCAGG No data
1114758018_1114758028 25 Left 1114758018 14:25282192-25282214 CCAGCAAACACTGTATTTCCCTT No data
Right 1114758028 14:25282240-25282262 GGGAACCCAAAGTGTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114758018 Original CRISPR AAGGGAAATACAGTGTTTGC TGG (reversed) Intergenic
No off target data available for this crispr