ID: 1114761069

View in Genome Browser
Species Human (GRCh38)
Location 14:25315120-25315142
Sequence ACATATTTGCACAATTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114761069_1114761070 -2 Left 1114761069 14:25315120-25315142 CCATCAAAATTGTGCAAATATGT No data
Right 1114761070 14:25315141-25315163 GTAAAATCTTCTCATCTCCCAGG No data
1114761069_1114761071 -1 Left 1114761069 14:25315120-25315142 CCATCAAAATTGTGCAAATATGT No data
Right 1114761071 14:25315142-25315164 TAAAATCTTCTCATCTCCCAGGG No data
1114761069_1114761072 10 Left 1114761069 14:25315120-25315142 CCATCAAAATTGTGCAAATATGT No data
Right 1114761072 14:25315153-25315175 CATCTCCCAGGGCTTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114761069 Original CRISPR ACATATTTGCACAATTTTGA TGG (reversed) Intergenic
No off target data available for this crispr