ID: 1114761349

View in Genome Browser
Species Human (GRCh38)
Location 14:25318973-25318995
Sequence GCCATTAATGCCTACATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114761349_1114761351 27 Left 1114761349 14:25318973-25318995 CCTTTGATGTAGGCATTAATGGC No data
Right 1114761351 14:25319023-25319045 TATTATATCCCATAGATTTTGGG No data
1114761349_1114761350 26 Left 1114761349 14:25318973-25318995 CCTTTGATGTAGGCATTAATGGC No data
Right 1114761350 14:25319022-25319044 GTATTATATCCCATAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114761349 Original CRISPR GCCATTAATGCCTACATCAA AGG (reversed) Intergenic
No off target data available for this crispr