ID: 1114764838

View in Genome Browser
Species Human (GRCh38)
Location 14:25359166-25359188
Sequence TTCAGCTAACTCCAGATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114764838_1114764842 8 Left 1114764838 14:25359166-25359188 CCTAAAATCTGGAGTTAGCTGAA No data
Right 1114764842 14:25359197-25359219 TGTTGGTATTGTACATTCTATGG No data
1114764838_1114764841 -9 Left 1114764838 14:25359166-25359188 CCTAAAATCTGGAGTTAGCTGAA No data
Right 1114764841 14:25359180-25359202 TTAGCTGAAGGGTTCATTGTTGG No data
1114764838_1114764843 9 Left 1114764838 14:25359166-25359188 CCTAAAATCTGGAGTTAGCTGAA No data
Right 1114764843 14:25359198-25359220 GTTGGTATTGTACATTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114764838 Original CRISPR TTCAGCTAACTCCAGATTTT AGG (reversed) Intergenic
No off target data available for this crispr