ID: 1114767894

View in Genome Browser
Species Human (GRCh38)
Location 14:25395180-25395202
Sequence CAGGGCTGTCAGCACTAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114767888_1114767894 24 Left 1114767888 14:25395133-25395155 CCCTAATCAGGTGGAGGGAGAAG No data
Right 1114767894 14:25395180-25395202 CAGGGCTGTCAGCACTAGCGTGG No data
1114767889_1114767894 23 Left 1114767889 14:25395134-25395156 CCTAATCAGGTGGAGGGAGAAGG No data
Right 1114767894 14:25395180-25395202 CAGGGCTGTCAGCACTAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114767894 Original CRISPR CAGGGCTGTCAGCACTAGCG TGG Intergenic