ID: 1114767894 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:25395180-25395202 |
Sequence | CAGGGCTGTCAGCACTAGCG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1114767888_1114767894 | 24 | Left | 1114767888 | 14:25395133-25395155 | CCCTAATCAGGTGGAGGGAGAAG | No data | ||
Right | 1114767894 | 14:25395180-25395202 | CAGGGCTGTCAGCACTAGCGTGG | No data | ||||
1114767889_1114767894 | 23 | Left | 1114767889 | 14:25395134-25395156 | CCTAATCAGGTGGAGGGAGAAGG | No data | ||
Right | 1114767894 | 14:25395180-25395202 | CAGGGCTGTCAGCACTAGCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1114767894 | Original CRISPR | CAGGGCTGTCAGCACTAGCG TGG | Intergenic | ||