ID: 1114767919

View in Genome Browser
Species Human (GRCh38)
Location 14:25395436-25395458
Sequence TGAGGTTTCCTGTTGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114767917_1114767919 1 Left 1114767917 14:25395412-25395434 CCTTGAAGCTTAGAATCTTTCTA No data
Right 1114767919 14:25395436-25395458 TGAGGTTTCCTGTTGCTGCAAGG No data
1114767915_1114767919 22 Left 1114767915 14:25395391-25395413 CCCAGAATTTGGGCTTTTTGACC No data
Right 1114767919 14:25395436-25395458 TGAGGTTTCCTGTTGCTGCAAGG No data
1114767916_1114767919 21 Left 1114767916 14:25395392-25395414 CCAGAATTTGGGCTTTTTGACCT No data
Right 1114767919 14:25395436-25395458 TGAGGTTTCCTGTTGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114767919 Original CRISPR TGAGGTTTCCTGTTGCTGCA AGG Intergenic
No off target data available for this crispr