ID: 1114770212

View in Genome Browser
Species Human (GRCh38)
Location 14:25422155-25422177
Sequence CTTCGAAGGCTGAGGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114770212_1114770219 12 Left 1114770212 14:25422155-25422177 CCCTCTGGCCTCAGCCTTCGAAG No data
Right 1114770219 14:25422190-25422212 CAGGCATGTACCACCATGCCTGG 0: 535
1: 11266
2: 39330
3: 91139
4: 160448
1114770212_1114770218 -7 Left 1114770212 14:25422155-25422177 CCCTCTGGCCTCAGCCTTCGAAG No data
Right 1114770218 14:25422171-25422193 TTCGAAGTAGCTGGGACTACAGG 0: 14
1: 1992
2: 56139
3: 224674
4: 287410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114770212 Original CRISPR CTTCGAAGGCTGAGGCCAGA GGG (reversed) Intergenic
No off target data available for this crispr