ID: 1114770212 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:25422155-25422177 |
| Sequence | CTTCGAAGGCTGAGGCCAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1114770212_1114770219 | 12 | Left | 1114770212 | 14:25422155-25422177 | CCCTCTGGCCTCAGCCTTCGAAG | No data | ||
| Right | 1114770219 | 14:25422190-25422212 | CAGGCATGTACCACCATGCCTGG | 0: 535 1: 11266 2: 39330 3: 91139 4: 160448 |
||||
| 1114770212_1114770218 | -7 | Left | 1114770212 | 14:25422155-25422177 | CCCTCTGGCCTCAGCCTTCGAAG | No data | ||
| Right | 1114770218 | 14:25422171-25422193 | TTCGAAGTAGCTGGGACTACAGG | 0: 14 1: 1992 2: 56139 3: 224674 4: 287410 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1114770212 | Original CRISPR | CTTCGAAGGCTGAGGCCAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||