ID: 1114770218

View in Genome Browser
Species Human (GRCh38)
Location 14:25422171-25422193
Sequence TTCGAAGTAGCTGGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 570229
Summary {0: 14, 1: 1992, 2: 56139, 3: 224674, 4: 287410}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114770209_1114770218 11 Left 1114770209 14:25422137-25422159 CCTCCTGGGCTCATATGACCCTC No data
Right 1114770218 14:25422171-25422193 TTCGAAGTAGCTGGGACTACAGG 0: 14
1: 1992
2: 56139
3: 224674
4: 287410
1114770213_1114770218 -8 Left 1114770213 14:25422156-25422178 CCTCTGGCCTCAGCCTTCGAAGT 0: 2
1: 11
2: 178
3: 1956
4: 14767
Right 1114770218 14:25422171-25422193 TTCGAAGTAGCTGGGACTACAGG 0: 14
1: 1992
2: 56139
3: 224674
4: 287410
1114770210_1114770218 8 Left 1114770210 14:25422140-25422162 CCTGGGCTCATATGACCCTCTGG No data
Right 1114770218 14:25422171-25422193 TTCGAAGTAGCTGGGACTACAGG 0: 14
1: 1992
2: 56139
3: 224674
4: 287410
1114770208_1114770218 17 Left 1114770208 14:25422131-25422153 CCTCAACCTCCTGGGCTCATATG No data
Right 1114770218 14:25422171-25422193 TTCGAAGTAGCTGGGACTACAGG 0: 14
1: 1992
2: 56139
3: 224674
4: 287410
1114770212_1114770218 -7 Left 1114770212 14:25422155-25422177 CCCTCTGGCCTCAGCCTTCGAAG No data
Right 1114770218 14:25422171-25422193 TTCGAAGTAGCTGGGACTACAGG 0: 14
1: 1992
2: 56139
3: 224674
4: 287410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114770218 Original CRISPR TTCGAAGTAGCTGGGACTAC AGG Intergenic
Too many off-targets to display for this crispr