ID: 1114770219

View in Genome Browser
Species Human (GRCh38)
Location 14:25422190-25422212
Sequence CAGGCATGTACCACCATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302718
Summary {0: 535, 1: 11266, 2: 39330, 3: 91139, 4: 160448}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114770215_1114770219 4 Left 1114770215 14:25422163-25422185 CCTCAGCCTTCGAAGTAGCTGGG 0: 24
1: 4285
2: 112925
3: 321149
4: 227255
Right 1114770219 14:25422190-25422212 CAGGCATGTACCACCATGCCTGG 0: 535
1: 11266
2: 39330
3: 91139
4: 160448
1114770217_1114770219 -2 Left 1114770217 14:25422169-25422191 CCTTCGAAGTAGCTGGGACTACA 0: 15
1: 2042
2: 56115
3: 223696
4: 284839
Right 1114770219 14:25422190-25422212 CAGGCATGTACCACCATGCCTGG 0: 535
1: 11266
2: 39330
3: 91139
4: 160448
1114770213_1114770219 11 Left 1114770213 14:25422156-25422178 CCTCTGGCCTCAGCCTTCGAAGT 0: 2
1: 11
2: 178
3: 1956
4: 14767
Right 1114770219 14:25422190-25422212 CAGGCATGTACCACCATGCCTGG 0: 535
1: 11266
2: 39330
3: 91139
4: 160448
1114770210_1114770219 27 Left 1114770210 14:25422140-25422162 CCTGGGCTCATATGACCCTCTGG No data
Right 1114770219 14:25422190-25422212 CAGGCATGTACCACCATGCCTGG 0: 535
1: 11266
2: 39330
3: 91139
4: 160448
1114770212_1114770219 12 Left 1114770212 14:25422155-25422177 CCCTCTGGCCTCAGCCTTCGAAG No data
Right 1114770219 14:25422190-25422212 CAGGCATGTACCACCATGCCTGG 0: 535
1: 11266
2: 39330
3: 91139
4: 160448
1114770209_1114770219 30 Left 1114770209 14:25422137-25422159 CCTCCTGGGCTCATATGACCCTC No data
Right 1114770219 14:25422190-25422212 CAGGCATGTACCACCATGCCTGG 0: 535
1: 11266
2: 39330
3: 91139
4: 160448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114770219 Original CRISPR CAGGCATGTACCACCATGCC TGG Intergenic
Too many off-targets to display for this crispr