ID: 1114772975

View in Genome Browser
Species Human (GRCh38)
Location 14:25450082-25450104
Sequence GTGTAGATTGTGAGCAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114772975_1114772978 -4 Left 1114772975 14:25450082-25450104 CCCTGGTTGCTCACAATCTACAC No data
Right 1114772978 14:25450101-25450123 ACACTCAAGCATGGCATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114772975 Original CRISPR GTGTAGATTGTGAGCAACCA GGG (reversed) Intergenic
No off target data available for this crispr