ID: 1114772978

View in Genome Browser
Species Human (GRCh38)
Location 14:25450101-25450123
Sequence ACACTCAAGCATGGCATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114772970_1114772978 20 Left 1114772970 14:25450058-25450080 CCCAAGTTTACAAGCCTTTGTTG No data
Right 1114772978 14:25450101-25450123 ACACTCAAGCATGGCATGTATGG No data
1114772974_1114772978 6 Left 1114772974 14:25450072-25450094 CCTTTGTTGGCCCTGGTTGCTCA No data
Right 1114772978 14:25450101-25450123 ACACTCAAGCATGGCATGTATGG No data
1114772969_1114772978 21 Left 1114772969 14:25450057-25450079 CCCCAAGTTTACAAGCCTTTGTT No data
Right 1114772978 14:25450101-25450123 ACACTCAAGCATGGCATGTATGG No data
1114772975_1114772978 -4 Left 1114772975 14:25450082-25450104 CCCTGGTTGCTCACAATCTACAC No data
Right 1114772978 14:25450101-25450123 ACACTCAAGCATGGCATGTATGG No data
1114772976_1114772978 -5 Left 1114772976 14:25450083-25450105 CCTGGTTGCTCACAATCTACACT No data
Right 1114772978 14:25450101-25450123 ACACTCAAGCATGGCATGTATGG No data
1114772971_1114772978 19 Left 1114772971 14:25450059-25450081 CCAAGTTTACAAGCCTTTGTTGG No data
Right 1114772978 14:25450101-25450123 ACACTCAAGCATGGCATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114772978 Original CRISPR ACACTCAAGCATGGCATGTA TGG Intergenic
No off target data available for this crispr