ID: 1114775986

View in Genome Browser
Species Human (GRCh38)
Location 14:25482048-25482070
Sequence CCTCATAAACAACTGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114775986_1114775988 9 Left 1114775986 14:25482048-25482070 CCTGGCTTCAGTTGTTTATGAGG No data
Right 1114775988 14:25482080-25482102 ACTCTTGATCCTCAGACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114775986 Original CRISPR CCTCATAAACAACTGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr