ID: 1114775988

View in Genome Browser
Species Human (GRCh38)
Location 14:25482080-25482102
Sequence ACTCTTGATCCTCAGACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114775985_1114775988 10 Left 1114775985 14:25482047-25482069 CCCTGGCTTCAGTTGTTTATGAG No data
Right 1114775988 14:25482080-25482102 ACTCTTGATCCTCAGACAGCTGG No data
1114775984_1114775988 11 Left 1114775984 14:25482046-25482068 CCCCTGGCTTCAGTTGTTTATGA No data
Right 1114775988 14:25482080-25482102 ACTCTTGATCCTCAGACAGCTGG No data
1114775986_1114775988 9 Left 1114775986 14:25482048-25482070 CCTGGCTTCAGTTGTTTATGAGG No data
Right 1114775988 14:25482080-25482102 ACTCTTGATCCTCAGACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114775988 Original CRISPR ACTCTTGATCCTCAGACAGC TGG Intergenic
No off target data available for this crispr