ID: 1114776087

View in Genome Browser
Species Human (GRCh38)
Location 14:25483192-25483214
Sequence TTGCATAACCAGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114776079_1114776087 28 Left 1114776079 14:25483141-25483163 CCCTCCATGATTTAGGGTCAGTA No data
Right 1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG No data
1114776082_1114776087 24 Left 1114776082 14:25483145-25483167 CCATGATTTAGGGTCAGTAGGTA No data
Right 1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG No data
1114776080_1114776087 27 Left 1114776080 14:25483142-25483164 CCTCCATGATTTAGGGTCAGTAG No data
Right 1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG No data
1114776083_1114776087 -6 Left 1114776083 14:25483175-25483197 CCAGAATTATTCCAATCTTGCAT No data
Right 1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114776087 Original CRISPR TTGCATAACCAGCAGGAGGA AGG Intergenic
No off target data available for this crispr