ID: 1114780714

View in Genome Browser
Species Human (GRCh38)
Location 14:25535593-25535615
Sequence CTCAAAGTAAGCACAAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114780714_1114780716 3 Left 1114780714 14:25535593-25535615 CCTGACCTTGTGCTTACTTTGAG No data
Right 1114780716 14:25535619-25535641 CACTGAACTCTCATGCATTATGG No data
1114780714_1114780717 28 Left 1114780714 14:25535593-25535615 CCTGACCTTGTGCTTACTTTGAG No data
Right 1114780717 14:25535644-25535666 CTACTGAAATTTTATACTCACGG No data
1114780714_1114780718 29 Left 1114780714 14:25535593-25535615 CCTGACCTTGTGCTTACTTTGAG No data
Right 1114780718 14:25535645-25535667 TACTGAAATTTTATACTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114780714 Original CRISPR CTCAAAGTAAGCACAAGGTC AGG (reversed) Intergenic
No off target data available for this crispr