ID: 1114780761

View in Genome Browser
Species Human (GRCh38)
Location 14:25536083-25536105
Sequence CAGAACATGGAAAACTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114780757_1114780761 24 Left 1114780757 14:25536036-25536058 CCTAATGACAGAAATGTAAACAA No data
Right 1114780761 14:25536083-25536105 CAGAACATGGAAAACTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114780761 Original CRISPR CAGAACATGGAAAACTATTA AGG Intergenic
No off target data available for this crispr