ID: 1114784179

View in Genome Browser
Species Human (GRCh38)
Location 14:25575674-25575696
Sequence ATGCAAGAATAGATAGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114784179_1114784181 6 Left 1114784179 14:25575674-25575696 CCCTGTACTATCTATTCTTGCAT No data
Right 1114784181 14:25575703-25575725 ATCTTACTTAAAAAAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114784179 Original CRISPR ATGCAAGAATAGATAGTACA GGG (reversed) Intergenic
No off target data available for this crispr