ID: 1114792811

View in Genome Browser
Species Human (GRCh38)
Location 14:25679029-25679051
Sequence TGGCAGGGCGGTGCTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114792807_1114792811 -7 Left 1114792807 14:25679013-25679035 CCTAAAATGAAAATGTTGGCAGG No data
Right 1114792811 14:25679029-25679051 TGGCAGGGCGGTGCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114792811 Original CRISPR TGGCAGGGCGGTGCTTTTTC TGG Intergenic
No off target data available for this crispr