ID: 1114794110

View in Genome Browser
Species Human (GRCh38)
Location 14:25692985-25693007
Sequence AGCAAATGGTTTTGGAGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114794106_1114794110 0 Left 1114794106 14:25692962-25692984 CCACTTTAACTACACAATCCAGA No data
Right 1114794110 14:25692985-25693007 AGCAAATGGTTTTGGAGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114794110 Original CRISPR AGCAAATGGTTTTGGAGTTC CGG Intergenic
No off target data available for this crispr