ID: 1114808155

View in Genome Browser
Species Human (GRCh38)
Location 14:25862126-25862148
Sequence CATTGGAAGTGGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114808149_1114808155 9 Left 1114808149 14:25862094-25862116 CCATCTATCTAGCTATAAAGTTA No data
Right 1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114808155 Original CRISPR CATTGGAAGTGGAGGGAAGA TGG Intergenic
No off target data available for this crispr