ID: 1114811573

View in Genome Browser
Species Human (GRCh38)
Location 14:25906532-25906554
Sequence CTGACTGACCAGAAGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114811571_1114811573 5 Left 1114811571 14:25906504-25906526 CCTGAGGGAGGGATAACTTGGCT No data
Right 1114811573 14:25906532-25906554 CTGACTGACCAGAAGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114811573 Original CRISPR CTGACTGACCAGAAGGAACC AGG Intergenic
No off target data available for this crispr