ID: 1114815204

View in Genome Browser
Species Human (GRCh38)
Location 14:25949290-25949312
Sequence CAGTGGTAATAGAGAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114815204_1114815210 30 Left 1114815204 14:25949290-25949312 CCTTCATCTCTCTATTACCACTG No data
Right 1114815210 14:25949343-25949365 TAATTTTCTAATTAGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114815204 Original CRISPR CAGTGGTAATAGAGAGATGA AGG (reversed) Intergenic
No off target data available for this crispr