ID: 1114816485

View in Genome Browser
Species Human (GRCh38)
Location 14:25964918-25964940
Sequence CTGTGAAAGGGAAAGTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114816485_1114816491 30 Left 1114816485 14:25964918-25964940 CCCTTCAACTTTCCCTTTCACAG No data
Right 1114816491 14:25964971-25964993 AGGCAGCCTACCTGACATCTAGG No data
1114816485_1114816489 10 Left 1114816485 14:25964918-25964940 CCCTTCAACTTTCCCTTTCACAG No data
Right 1114816489 14:25964951-25964973 CTGCACTGAAATGCCATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114816485 Original CRISPR CTGTGAAAGGGAAAGTTGAA GGG (reversed) Intergenic
No off target data available for this crispr