ID: 1114821016

View in Genome Browser
Species Human (GRCh38)
Location 14:26019405-26019427
Sequence ACTCCTGGTGTGCCTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114821011_1114821016 12 Left 1114821011 14:26019370-26019392 CCAGATCCACTTTATCATCTTTT No data
Right 1114821016 14:26019405-26019427 ACTCCTGGTGTGCCTCAGCCTGG No data
1114821012_1114821016 6 Left 1114821012 14:26019376-26019398 CCACTTTATCATCTTTTCCCAAT No data
Right 1114821016 14:26019405-26019427 ACTCCTGGTGTGCCTCAGCCTGG No data
1114821010_1114821016 13 Left 1114821010 14:26019369-26019391 CCCAGATCCACTTTATCATCTTT No data
Right 1114821016 14:26019405-26019427 ACTCCTGGTGTGCCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114821016 Original CRISPR ACTCCTGGTGTGCCTCAGCC TGG Intergenic
No off target data available for this crispr