ID: 1114828798

View in Genome Browser
Species Human (GRCh38)
Location 14:26112794-26112816
Sequence TCTCTCATACATATCGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114828798_1114828799 3 Left 1114828798 14:26112794-26112816 CCAACTACGATATGTATGAGAGA No data
Right 1114828799 14:26112820-26112842 AACTAGAATATGTGATTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114828798 Original CRISPR TCTCTCATACATATCGTAGT TGG (reversed) Intergenic
No off target data available for this crispr