ID: 1114829092

View in Genome Browser
Species Human (GRCh38)
Location 14:26117344-26117366
Sequence CCAGCACATCTCTACATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114829092_1114829095 3 Left 1114829092 14:26117344-26117366 CCAGGCATGTAGAGATGTGCTGG No data
Right 1114829095 14:26117370-26117392 TAAAATGAAGAACACAGAGGTGG No data
1114829092_1114829096 18 Left 1114829092 14:26117344-26117366 CCAGGCATGTAGAGATGTGCTGG No data
Right 1114829096 14:26117385-26117407 AGAGGTGGCTGCTGTTTTCACGG No data
1114829092_1114829094 0 Left 1114829092 14:26117344-26117366 CCAGGCATGTAGAGATGTGCTGG No data
Right 1114829094 14:26117367-26117389 AAATAAAATGAAGAACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114829092 Original CRISPR CCAGCACATCTCTACATGCC TGG (reversed) Intergenic
No off target data available for this crispr